responte Question 29 Multipie Answer Question: Erwin Chargaff's rules state that in a typical double-stranded DNA: On %A = %T 176 %A+ %G = %T + %C (J0. %A = %U E%A %T %G+%C DF "GA - %G OG. %A = %0
Q: Bacterial DNA has how many origins of replication? A) 0 B) 1 C) 10 D) depends on the size of…
A: Two identical copies of a DNA molecule are produced by DNA replication. This is important for cell…
Q: How important and useful to the cell is the ability of the DNA to assume various forms? Why are…
A: Topic: an essay on " Ability of DNA to assume various forms and their importance ".
Q: In figure 10.16 , how would the curve appear if the GC content of the DNA sample were increased? How…
A: Introduction: DNA is made of four nucleotide bases that are adenine (A), thymine (T), guanine (G),…
Q: What defines one end of a DNA molecule as the 5’ end? a. What defines the other end at the 3’ end?…
A: DNA is made up of molecules called nucleotides. It is a molecule composed of two polynucleotide…
Q: Chargaff's rule applies to: Group of answer choices A. only RNA B. both DNA and RNA C. only DNA…
A: INTRODUCTION chargaff's rule This rule state that the purine and pyrimidine bases of DNA of any…
Q: explains how the underwinding of a B-DNA helix might facilitate or stabilize the formation of Z-DNA
A: Dideoxy ribonucleic acid (DNA), ribonucleic acid (RNA), and proteins play an essential role in the…
Q: Calculated Numeric Question. A sample of DNA isolated from new bacterium contains 34.3% of guanine…
A: According to Chargaff's rule the amount of purine should be equal to amount of pyrimidine and also…
Q: Prior to the action of DNA ligase, how many hydrogen bonds are holding these two DNA fragments…
A: Deoxyribonucleic acid can be defined as the molecule that is composed of two polynucleotide chains…
Q: a. How do you set up the tanks? b. Why do DNA fragments move? C. How do DNA fragments move relative…
A: There are multiple questions in this particular question, I will answer the first three sub parts…
Q: The enzyme responsible for separating double-stranded DNA intosingle-stranded DNA isa. DNA…
A: Genetics is a piece of science worried about the assessment of genes, genetic collection, and…
Q: Compare and contrast the activity of a topoisomerase and a helicase in the context of DNA…
A: The process of replication of DNA is a semi-conservative method, which suggest that the parental…
Q: In a DNA double stranded molecule, if 5% of the bases are cytosine, what percent of the bases are…
A: [Deoxyribonucleic acid ]DNA It's an organic compound which includes genetic data & protein…
Q: The orginal strand is 5' G-A-C-C-A-T 3' Question: What is the new replicated DNA strand? The…
A: In atomic science, DNA replication is the natural procedure of creating two indistinguishable copies…
Q: Suggest a reason why it would be unlikely for replication to take place without unwinding the DNA…
A: Nucleic acids are the major class of biomolecules that are important for all forms of the organism.…
Q: AKS 5b: Use the models beklow to answer the question that follows. Whic model and explanation best…
A: Conservative replication leaves the two original template DNA strands together in a double helix and…
Q: Choose the combination of answers that most accurately completes the statement.The function of…
A: Enzymes are kind of biological molecules mostly proteins which speed up the rate of different…
Q: Comparing the plant (banana) and animal (human cheek cell) samples, which has more DNA? Take note…
A: Banana's share 60% of the DNA as that of humans.
Q: How does discontinuous synthesis of the lagging strand keep up with continuous synthesis of the…
A: The DNA is always synthesized in the 5′ → 3′ directly with nucleoside triphosphates (NTPs) acting as…
Q: how the double-helical structure of DNA suggests a mechanism for DNA replication?
A: Prokaryotes DNA replication occurs in three steps Initiation- a) Recognition of the position for…
Q: Refer to the image and answer the questions 1. How are Okazaki fragments joined together? 2. Where…
A: The replication fork is a structure that forms within the long helical DNA during DNA replication.…
Q: Below is a double strand DNA sequence contain a gene and it will go under transcription, suppose…
A: Introduction Translation is the process through which a cell uses the genetic information relayed in…
Q: Given the choices, a. 25 b. 18 c. 23 d. 21 how many hydrogen bonds are present in a DNA double…
A: DNA is also known as deoxyribonucleic acid. DNA acts as genetic material in most of the organisms…
Q: What was the purpose of the sodium chloride in nucleic acid extraction? CHOOSE ALL ANSWERS THAT…
A: INTRODUCTION Nucleic acid extraction It is the process of isolation, purification and concentration…
Q: Does the semi-conservative nature of DNA
A: Semiconservative DNA Replication: It is the mode of replication in which DNA strand which is duplex…
Q: . In analyzing the number of different bases in a DNAsample, which result would be consistent with…
A: The DNA (Deoxyribonucleic acid) comprises two types of nitrogenous bases including the purines and…
Q: Suppose Meselson and Stahl had done theirexperiment the other way around, starting with cells fully…
A: Introduction: Meselson and Stahl conducted an experiment with the E.coli DNA which proved the…
Q: Use the single strand of DNA below to answer the next two questions: 5' AGTTACCT 3' What is the base…
A: Nucleotides are the building blocks of nucleic acid. Nucleotide consists of three distinct…
Q: DNA Fragments: CGATCT TCACGA AGCTGC GGCTAA ATGCTG GTACCA Select the correct fragments from the…
A: DNA is a nucleic acid that is present in the nucleus of eukaryotic cells and the nucleoid region of…
Q: Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the…
A: * Okazaki fragment are short sequences of DNA nucleotides. * They are of approximately 150 to 200…
Q: Use the gel to answer the following questions. You will be constructing a map of the plasmid,…
A: Plasmids are circular double-stranded DNA elements. These are found in prokaryotes. The plasmids…
Q: QUESTION 5 Observe this replication fork. The lagging strand is the O Top O Bottom Click Save and…
A: Answer - BOTTOM.
Q: (AKS 8a2 DOK 2) Some students in the biology classes at Meadowcreek HS analyzed DNA on a gel. The…
A: DNA fragments are negatively charged, so they move towards the positive electrode. Because all DNA…
Q: Table 1: Characteristics of DNA Questions To what maior group of biomolecules does DNA belong? wers…
A: INTRODUCTION DNA Deoxyribonucleic acid is the heriditary material present in humans and other…
Q: 1. What is the total size of the PMBBS plasmid in bp? Answer: bp 2. How many cut sites on the pMBBS…
A: As per the guidelines, we are supposed to answer only three subparts. Kindly repost the question…
Q: Answer the above question for CutVI if the starting DNA were linear instead of circular.
A: Restriction enzymes are enzymes that identify specific sequences in DNA and cut DNA at or near these…
Q: Describe what is happening with time and explain why the DNA forms a discrete band. * Your answer…
A: Meselson and Stahl experimentally demonstrated the semiconservative replication of DNA in E. coli…
Q: From which end of a strand of nucleic acid does DNA polymerase I REMOVE nucleotides? A) 5' B) 3'…
A: DNA polymerase 1 has three types of polymerase activity. 1. 5'-3' polymerase activity- It is…
Q: Suppose a region of DNA is 100 bp long. How many unique sequences could it potentially represent?…
A: DNA or deoxyribonucleic acid is the genetic material in living organisms that contain specific…
Q: AKS 5b: Which model accurately represents the semi-conservative nature of DNA replication? * AA AA…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Genetics Attached is a segment of DNA (doublestranded). Answer the following questions about the…
A: Open reading frame is a part of genetic material which is responsible for expressing itself in the…
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 3.…
A: DNA is composed of two polynucleotide strands which wrapped around each other like helix- like…
Q: Below is a diagram of DNA replication as currently believed to occur in E. coli. Arrows start from…
A: DNA replication is the process of producing two identical replicas of DNA from one original DNA…
Q: Question 1 Review DNA sequencing, which method uses a dideoxy chain termination? O Next-generation…
A: Dideoxynucleotides are DNA polymerase chain-elongating inhibitors utilised in the Sanger technique…
Q: If you took more of the same randomly generated 1000 bp fragments of binturong DNA (the same sample…
A: Agarose gel electrophoresis is the technique of separation of DNA fragments of different length…
Q: Question 1 Origin 5' 3' 3 5' Unwinding Unwinding Origin Question 1: The following diagram (below)…
A: Replication is a process by which the DNA is duplicated to form two identical copies of DNA using…
Q: Given the choices, a. 26 b. 23 c. 27 d. 21 how many hydrogen bonds are present in a DNA double…
A: The sequence is- GCTGTGCACT The complementary strand is- CGACACGTGA The rules of base pairing (or…
Q: tate Chargaff’s rules. How did these rules help to discern the structure of DNA?
A: There are two types of nucleic acids, deoxyribonucleic acid or DNA and ribonucleic acid or RNA. Both…
Q: Based on one strand of a certain segment of DNA with the sequence below, answer the following…
A: DNA, deoxyribonucleic acid is a molecule which stores the genetic information of an organism and…
Q: Fill in the palindromic sequence of the given DNA strand containing six bases.
A: A palindromic DNA sequence is a sequence made of nucleic acids with double helix of DNA /RNA that…
Q: Explain why cheek cells are diploid, and how does this affect the DNA?
A: Cheek cells are squamous epithelial cells that form the lining of the buccal cavity. They have a…
Step by step
Solved in 2 steps
- 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.Transcribe and translate the following DNA sequence (nontemplate strand): 5'- ATGGCCGGTTATTAAGCA-3'Which of the following phases is characterized by preparation for DNA synthesis? G0 G1 G2 S
- a. Draw roughly the comparative electrophoretic mobilities of close circular DNA, open circular DNA and super coiled DNA, all having the same molecular weight. Why is the separation possible given that all the DNAs (in (a)) have the same molecular weight?You are given a segment of DNA : 5’ - CATGTCAAC – 3’ What is the complimentary strand?Polymerases work is to add 10 nucleotides to a DNA strand before dissociating. During replication process, DNA pol III can add tens of thousands of nucleotides at a moving fork. How this additionaccomplished?
- Base on the coding strand of DNA: ATG GGA ATT CGC What is the sequence of the complementary template strand of DNA that pairs with the coding strand?he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′22. A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a template for DNA replication, which of the following correctly depicts the sequence of the newly synthesized strand in the direction in which it will be synthesized? Group of answer choices 1. 5' TTACCGAAT 3' 2. 3′ TTACCGAAT 5′ 3. 5′ TAAGCCATT 3′ 4. 3′ AATGGCTTA 5′
- DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, whats the non-template/sense/coding strand from the STARND DNA? also what's the arrangement of m-RNA and the chain arrangement of the amino acids that will be made according to the order of the RNA?PLS DONT ANSWER THE DEFINITION ONLY, READ THE QUESTION CAREFULLYPolymerases usually add only about 10 nucleotides toa DNA strand before dissociating. However, during replication, DNA pol III can add tens of thousands ofnucleotides at a moving fork. How is this additionaccomplished?3. Replicate the following segment of DNA. 5'-ATCGGCTACGTTCAC-3' 3'- TAGCCGATGCAAGTG-5'; and show the direction of the new strands and explain lagging and leading strands are, also explain how this is semiconservative replicatication. Are the new strands identical to the original segments of DNA?
