Question 4 About endonucleases: A Restriction endonucleases always cut double-stranded DNA and are endo- deoxyribonucleases. B Once the DNA sequence is recognized, they cleave the bond between the desoxyri- bose and the nitrogenous base. |C they are proteins that are necessary for the replication of DNA. D they act on single-stranded DNAS, RNAS, and double-stranded DNAS. E they are enzymes whose substrate is a double-stranded sequence of nucleic acids, DNA or RNA, or hybrid DNA-RNA.

Question 4 About endonucleases: A Restriction endonucleases always cut double-stranded DNA and are endo- deoxyribonucleases. B Once the DNA sequence is recognized, they cleave the bond between the desoxyri- bose and the nitrogenous base. |C they are proteins that are necessary for the replication of DNA. D they act on single-stranded DNAS, RNAS, and double-stranded DNAS. E they are enzymes whose substrate is a double-stranded sequence of nucleic acids, DNA or RNA, or hybrid DNA-RNA.

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

QUESTION NO. 1 A transition mutation A. occurs when a purine is substituted for a pyrimidine or vice versa. B. results from the insertion of one or two bases into the DNA chain. C. is most frequently caused by chemicals (like acridine) that intercalate into DNA. D. results from substitution of one purine for another or of one pyrimidine for another. E. always is a missense mutation QUESTION NO. 2 Degeneracy of the generic code denotes the existence of A. multiple codons for a single amino acid. B. codons consisting of only two bases. C. base triplets that do not code for any amino acid. D. different systems in which a given trip let codes for different amino acids. E. codons that include one or more of the unusual bases. QUESTION NO. 3 Replication A. requires that a phosphodiester bond of the incoming dNTP be hydrolyzed in order to be added to the growing chain. B. uses 5' to 3' polymerase activity to synthesize one…
QUESTION 12 The leucine zipper domain of transcription factors is not involved in DNA recognition but rather in facilitating dimerization. Given the chemical properties of the amino acid leucine, dimerization of transcription factors via this domain by (select the correct option). Facilitating hydrogen bonding with the aqueous environment. Chelation of bivalent ions such as Zn2+. Formation of coiled-coils through hydrophobic non-covalent interactions between evenly spaced Leu residues in alpha-helical domains. Physically connecting the two transcription factor subunits through unstructured loops.
QUESTION NO. 1 Patients with the rare genetic disease xeroderma pigmentosum (XP) are very sensitive to light and are highly susceptible to skin cancers. The study of such patients has enhanced our knowledge of DNA repair because XP is caused by defective DNA repair nucleotide excision repair. (A variant, XP-V, is deficient in postreplication repair.) In nucleotide excision repair A. removal of the damaged bases occurs on only one strand of the DNA. B. only thymine dimers generated by UV light can be removed . C. the excision nuclease is an exonuclease. D. a single multifunctional enzyme carries out the repair process. E. only the damaged nucleotides are removed. QUESTION NO.2 Homologous recombination: A. occurs only between two segments from the same DNA molecule. B. requires that a specific DNA sequence be present. C. requires one of the duplexes undergoing recombination be nicked in both strands. D. involves a…
QUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.
Question-1 During DNA replication, a.No errors occur b.only one strand of the molecule acts as a template c.Both strands of a molecule act as templates. d.The reaction is catalyzed by RNA polymerase
QUESTION 22 The DNA sequences that are most conserved between human and mouse would most likely be located in: A Highly-repeated sequences, such as microsatellite regions B Highly repeated sequences, such as Alu sequences C Moderately-repeated non-coding sequences D Coding regions of single-copy genes
QUESTION 24 During lagging strand synthesis of DNA, Okazaki fragments are linked together by ___________. DNA polymerase I Primase Beta clamps DNA Ligase
QUESTION 25 During lagging strand synthesis of DNA, the RNA primers are replaced with DNA by __________. DNA Polymerase I DNA Polymerase II DNA Polymerase III Primase
QUESTION 25 What is the most common type of DNA sequence present in eukaryotic genomes? A. Repetitive DNA sequences B. Minisatellites C. Exons of genes encoding proteins D. Introns of genes encoding proteins
MCQ QUESTION: In Bacteria, the UV-induced DNA damage will be repaired by ------- where -------- nitrogenous base is targeted. A- Photoreactivation repair/ b- thymine SOS repair/ C-adenine Mismatch repair/ D- cytosine Proofreading/guanine The DNA sequence (5'-ATACAMA-3') was exposed to Ethyl Methanesulfonate (EMS) which is a(n) _______ . The resulting DNA sequence will become __________ after one round of cell division.
Question 1. Although we will not be doing a gel electrophoresis, data from a gel digest of a Bacillus anthrax plasmid is provided so you can do a DNA map. The Bacillus anthrax plasmid is 4000bp (4Kb) long. Note the origin position as well as the reference molecular weight markers on the gel. Two restriction enzymes, A and B, were used to obtain two individual digests, A and B. They were combined to produce the third digest. The restriction enzyme fragment pattern for the digest of Bacillus anthrax plasmid Determining the Number of Fragments How many fragments were produced by enzyme A? How many fragments were produced by enzyme B? How many fragments were produced by the combined digest (A and B)? Fragment Size Fragment size is relative to molecular weight, and must be determined by comparing the fragment distance to the molecular weight markers. The fragment size has been provided on the gel pattern for this exercise. To make a map you must determine the relative positions of the…
Question Number-1: Using complementary base pairing method, convert the following DNA sequence into RNA sequence. DNA: TACGGCGCGTATACGACT