Question 5 Early classifications of the polar bear were based on reproductive isolation from brown bears. evolutionary history. appearance and behavior. metapopulations that exchange alleles.
Q: transalational control is dependent on the stability of mRNA molecules
A: Translational mechanisms can also be used to modulate gene expression. These techniques are…
Q: DODO 0 0 Consider the characteristics given on the first column of Table 18. Put a check on the…
A: When researching biological entities, following a predefined hierarchy and order makes it easier to…
Q: Please answer the recent examples or studies about cloning entire organisms in 1. Plants 2. Animals
A: Cloning is a laboratory procedure that creates genetically identical organisms via non-sexual ways.…
Q: How might one test whether the differences in moth density in the two types of plants are due to…
A: Answer :- When sent consistently in the field, hereditarily controlled plant obstruction is…
Q: 1. Methylation of DNA and acetylation of histones are directly correlated. 2. Histone demethylation…
A:
Q: In humans, the genes for red-green color blindness (R = normal, r = color blind) and hemophilia A (H…
A: Given: In humans, The genes for red-green color blindness (R = normal, r = color blind) and…
Q: metabolize aerobically and anaerobically. refers to pathways that take place in the presence of…
A: The human body needs glucose to make adenosine triphosphate (ATP) molecules during the aerobic…
Q: CRITICAL THINKI 1. The red blood cell enzyme carbonic anhydrase contains a zinc cofactor. A diet…
A: Carbonic anhydrase is an enzyme that speeds up the conversion of carbon dioxide and water into…
Q: statement is true. Both statements are false. 1. Epigenetics does not consider how exposure to…
A: Epigenetics is the study of how your behaviour and environment can influence how your genes…
Q: Match each structure with its descriptions. ____ radula a. internal skeleton…
A: Human anatomy and physiology are concerned with how the human body works to keep itself alive and…
Q: How do bacteria and archaea differ from each other? Contrast prokaryotic cells with eukaryotic…
A: Prokaryotes include Archaea and Bacteria, which are two different types of microbes. Archaea and…
Q: True or false. The supercontinent pangaea formed about four billion years ago.
A: A supercontinent is a landmass that contains most or all of the land on Earth. The landmass formed…
Q: If you mated an F' bacterial cell with lacl+ lacP+ lacO+ lacZ+ lacY+ on the bacterial chromosome and…
A: β-galactosidase gene (PbBGal2A) from Paenibacillus barengoltzii expressed in E. coli; the enzyme…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…
A: As per our Guidelines we are not allowed to answer more than three sub parts at a time.
Q: 1) An ad for a new beauty treatment claims that it, "repairs the tiny cracks in your cell…
A: The cell membrane is sometimes referred to as a fluid mosaic model because it contains a variety of…
Q: functional insulin required the association of two polypeptides known as the A and B chains…
A: Pre transcription control involves in DNA methylation. Transcriptional control involves in…
Q: association of 2alpha and 2 beta chains to form adult hemoglobin identify which describes the…
A: Translation is process of conversion of RNA to protein.
Q: A urine sample with more than 100,000 organisms is considered indicative of infection. A urine…
A: Urine microscopy is a diagnostic tool used in diagnosis of various diseases such as bacterial…
Q: Determine the ventricular electrical axis in the following recording: Explain your answer
A: The ECG's axis is one of the major direction in which the overall electrical activity of the heart…
Q: 2.How does hydrochloric acid aid in the digestion of food? Read and analyze the question and choices…
A: The digestive system made up of different organs helps in the digestion of food. The stomach is the…
Q: Evaluate whether the statements I and II are TRUE or FALSE.
A: Euchromatin is the light staining and less condensed portions of chromatin. This region is…
Q: Arrange the statements in their proper order by writing the corresponding letter (e.g. A) for each…
A: * Gene activation and inactivation are the complicated and multistep which are the controlled…
Q: Briefly describe endocrine disruptors, how they act, toxicity caused and the effects they bring…
A: Hormones are chemical substances produced by our body's endocrine system, which releases the…
Q: in the abs The diagram shows the process of cellular respiration both in the presence an oxygen.…
A: Aerobic respiration takes place in the presence of oxygen. The fermentation pathways of energy…
Q: RNA to DNA, Ribosome, cytoplasm DNA, nucleus, cytoplasm Proteins, Nucleus, ribosome Proteins,…
A: The process through which cellular ribosomes produce proteins is known as translation. A ribosome…
Q: 6. List two factors that can create incomplete or low quality data in genomics, and 2) their…
A: *Data integration is relevant in genomics because health related decisions depend on it. * After…
Q: In people, the trait for colorblindness (Xb) is a recessive sex linked trait and normal vision (XB)…
A: Introduction:- Color blindness is the inability to distinguish between the three primary colours of…
Q: According to the progressive, or escape, hypothesis, viruses (a) appeared before the three domains…
A: Virus is a relation between living and non living world and it is infectious. This is because ,…
Q: Explain how snakes are related to lizards
A: Snakes and lizards are closely related to each other that belongs tothe order squamata of the…
Q: Bacterial DNA will be recognized by innate immune cells though binding to: O TLR8 O TLR9 TLR2 TLR4
A: Innate Immunity: Immunity that is innate, or nonspecific, is a protective system that you were born…
Q: In 1798, a stuffed platypus specimen was delivered tothe British Museum. Reports that it laid eggs…
A: Amniotes are described as the vertebrates that have a tendnecy to develop embryo in the amnion.…
Q: Which of the following statements BEST explains the relationship between the parts of genetic…
A: The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic acid.…
Q: 5. Larry and Lola Little have achondroplasia, a form of dwarfism. Both are heterozygotes. Their son,…
A: Heterozygous condition is defined as a condition in which two variations of a gene known as alleles…
Q: Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’…
A: Template DNA: 5’ATGACGGAATATAAGCTGGTGGTGGTGGGGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’…
Q: 18. Which of the following entities has the largest interaction cross-section (most likely to…
A: Tissues are group of cells having similar function and structure.
Q: Why are the testes located outside of the body of organisms?
A: Testes is located outside the abdominal cavity. Testes is present inside scrotum.
Q: 5. In mice, black color (B) is dominant to white (b). At a different locus, a dominant allele (A)…
A: Phenotype is the physical look of a bodily character. Phenotypic ratio refers to the rate or…
Q: Match the organisms with the appropriate description. ___ lancelets a. pouched mammals ___…
A:
Q: The following DNA sequence is a bacterial promoter with numbered nucleotides. The 3' end is the…
A: Which nucleotide number is the 5' end of 35 site- T Which nucleotide number is the 3' end of…
Q: RNAi (or RNA interference) is the process of creating double-stranded RNA in the cells. Explain how…
A: * RNA interference (RNAi) also called as Post Transcriptional Gene Silencing whi h is an conserved…
Q: the glycolytic enzyme pyruvate kinase is activated by dephosphorylation and inactivated by…
A: Pyruvate kinase It's an important glycolysis enzyme that helps converting PEP (phosphoenolpyruvate)…
Q: a separate sheet of paper. 3 MONTHS MONTHS MONTHS MONTHS 6 MONTHS 5 MONTHS PROCESS: FETAL…
A: Humans are sexually reproducing and Vviparous. The reproductive events in humans inciude formation…
Q: Aspartate and phenyalanine become apartate and isoleucine
A:
Q: 3) Whole-mount in situ hybridization can be used to test for the function of non-coding DNA region.…
A: * Whole mount in situ hybridization is a tool that aids for temporal and spatial dissection of gene…
Q: Which of the following describes passive immunity? Note: This is a multiple question, choose the…
A: When an individual receives antibodies to a disease instead of developing them by his or her own…
Q: Explain the positive and negative results of ELISA.
A: Introduction ELISA is an acronym for enzyme-linked immunoassay. Antibodies in the blood are detected…
Q: Define death in physiological terms. We know that when the human heart stops beating, it can be…
A: The cardiovascular system is a network of arteries and veins in which the heart pumps blood. One of…
Q: 9. In snakes, the recessive genotype cc causes the animal to be albino despite the inheritance of…
A: Given cc - albino snake B - dominant allele (black snake) Parents genotype = CcBB
Q: 2.If Peter is allergic to peanuts and Paul is not, what is the precise molecular difference in…
A: 2. If Peter is allergic to peanuts and Paul is not, what is the precise molecular difference in…
Q: In fruit flies, the allele for long wings (L) is dominant to the allele for short wings (l). If a…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…
5
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- QUESTION 22 Tiktaalik and Archaeopteryx are very important transitional forms. They provide evidence for evolution through examples of: a. microevolution b. macroevolution c. migration d. speciationQUESTION 9 Recent genetic research indicates that ____ or more individuals are needed for an endangered species to maintain its capacity for biological evolution. a. 100 b. 1,000 c. 10 d. 100,000 e. 10,000QUESTION 8 Morphological differences are abundant among many species. We make assumptions about why adaptations exist, but to understand whether a specific trait is a adaptive and why, researchers must create experiments that have all the following, EXCEPT: a. replication of each treatment to ensure reliability of results. b. hypotheses that are testable and falsifiable. c. include control groups. d. exceedingly small sample sizes in each treatment group. e. experimental design that enables all full interpretation of differences.
- QUESTION 18 Describe: Population aging and increased longevity are creating more multi- and intergenerational families in the U.S. Give two examples of ways in which family structure and family roles are changing because of these changes.QUESTION 16 You are examining a beloved population of trillium in the backyard of your childhood home. You recall as a child that flowers were bright white. As you return to the population you note that many (but not all) of the flowers have a faint purple vertical stripe in the middle of each petal. List each of Darwin’s postulates and what must be true about your population if it has undergone evolution by natural selection for petal color.QUESTION 17 The current rate of extinction is ____ , compared to the historical background extinction rate. a. almost 1,000 times lower b. slightly less c. about the same d. up to 1,000 times higher e. fluctuating wildly
- Question 3. There are 100 students in a class. Ninety-six did well in the course whereas four blew it totally and received a grade of F. Sorry. In the highly unlikely event that these traits are genetic rather than environmental, if these traits involve dominant and recessive alleles, and if the four (4%) represent the frequency of the homozygous recessive condition, please calculate the following: A) The frequency of the recessive allele. B) The frequency of the dominant allele. C) The frequency of heterozygous individuals. Question 4 Within a population of butterflies, the colour brown (B) is dominant over the colour white (b). And, 40% of all butterflies are white. Given this simple information, which is something that is very likely to be on an exam, calculate the following: A) The percentage of butterflies in the population that are heterozygous. B) The frequency of homozygous dominant individuals. Question 5 A rather large population of organisms have 396 red-sided individuals…Questions for Years since Separation:1) When genetic researchers compare the DNA of Northern Asian population versus NativeAmerican populations, they find a 0.07% difference. The “Mitochondrial Clock” formula tells usthat there has been about _____________ years since the separation of these two groups.2) When comparing the DNA of Northern Asians and European populations, they discovered a0.1% difference. The “Mitochondrial Clock” formula tells us that there has been about______________ years since the separation of these two groups.3) When comparing the DNA of Indonesian peoples to either the European group or the NorthernAsians, they find a 0.12% difference. The Mitochondrial Clock formula tells us that there hasbeen about _____________ years since the separation of these two groups.4) When researchers compare the DNA of African populations to any other group they find a 0.2%difference. The Mitochondrial Clock formula tells us that there has been about__________________ years since…QUESTION 23 Allele frequencies for eye color in a population of hippogriffs is p=0.73. How many individuals would you expect to be heterozygous in a population 150? (Assume HWE)
- QUESTION 6 A major reason for preventing extinction is the belief of many people that ____. a. all species have economic value b. there is recreational value of species to humans c. wild species have a right to exist d. nature has a spiritual value e. animals have the same rights as humansQUESTION 14 Darwin’s finches on the Galapagos Islands are a group of species of finches. One of the major features noted is the variation in beak depth. We spent some time talking about the variation in the ground finch population and how that changed overtime and how that change corresponded to changes in environmental conditions, which affected food item characteristics and abundance. The changes in beak depth over time is a result of… a. natural selection b. gene flow c. sexual selection d. artificial selectionQUESTION 19 People who specifically study the growth patterns and socioeconomic characteristics of human populations are called ___. a. demographers b. crytographers c. geographers d. environmentalists e. ecologists