Q: a species that has a diploid number 2n = 10. Draw this cell as you would expect it to appear during…
A: * cell cycle meiosis consists of four stages Prophase Metaphase Anaphase Telophase * In prophase…
Q: 21. The best explanation for the red-eyed F1 females is (A) mutation (B) culture contamination (C)…
A: A culture of white-eyed fruit flies (Drosophila melanogaster) was maintained for many generations.…
Q: Discuss the relative importance of PO2, PCO2, pH and blood glucose level in regulating cerebral…
A: Cerebral blood flow is a blood flow to provide blood to cerebral of brain which is very important…
Q: There are many immunotherapeutics now being used to immunomodulate recipients that are either fully…
A: Wellbeing and immunotoxicity appraisal of immunomodulatory monoclonal antibodies Most remedial…
Q: The bulldog ant has a diploid number of two chromosomes. Imagine a bulldog ant cell is heterozygous…
A: Mitosis is a cell division process that involves production of two diploid (2n) daughters cells from…
Q: Compare and contrast PCR and the cycles used in Sanger sequencing
A: DNA sequencing is the process of determining the sequence of nucleotide bases (As, Ts, Cs, and Gs)…
Q: Suppose that you are interested in estimating a population mean. You select a random sample of…
A: A confidence interval for a population mean with a known population standard deviation is based on…
Q: A woman with a colorblind father marries a colorblind man. What would be all possible genotypes and…
A: ANSWER) The possible genotypes would be- XcXc, XcY, XcX, XY Possible phenotypes would be 50% of the…
Q: What are the four major functions of the limbic system. D
A: The limbic system, which includes the hippocampus, hypothalamus, and amygdala, is a group of…
Q: Which test measures the average size of red blood cells?
A: Red blood cells(RBCs) or erythrocytes are blood cells containing a protein called haemoglobin which…
Q: The brain stem also includes the bulb-like
A: The swollen part of the central nervous system located in brainbox having cavities filled with…
Q: in general, how does the location and abundance of regulatory DNA sequences change with increasing…
A: Introduction A genome is an organism's complete set of genetic instructions, It consists of…
Q: In other words, the master regulator initiates a program of gene expression that narrow the…
A: Cell signalling
Q: "back of the brain" is the Notice the arbor vitae within it.
A:
Q: A woman with B type blood gives birth to a baby with O type blood. Which of the following men could…
A: The ABO blood group system is determined by multiple allelism. The presence of specific antigen on…
Q: Yes or No: If a species is a good intraspecific competitor, is it necessarily a good interspecific…
A: Competition is the matter of contention for food,,shelter and many other phenomenon. Interspecific…
Q: The human genome project wa first information on the human sequence was published in 200 steadily…
A: Much of the newly sequenced material is the “heterochromatic” part of the genome, which is more…
Q: Use the values of the oxygen partial pressure on both sides of the resistance membrane(Po2 = 100,…
A: The pulmonary diffusing capacity for oxygen is the quotient obtained by dividing the volume (ml.) of…
Q: Write short notes on the following: (a) Neural coordination (b) Forebrain
A: Answer : neural coordination : the neural coordination is the process in which there are two or…
Q: Give a graph showing the growth level of each microorganism according to the temperature and fill in…
A:
Q: A S8 years female came to the emergency department of a hospital complaining of pain and feeling…
A: 1. Symptoms include tightness or pain in the chest, neck, back or arms, as well as fatigue,…
Q: are the advantages and disadvantages of high levels of parental care in sharks?
A: Care (1) increase offspring survival during the stage in which parents and offspring are…
Q: The part of the sperm containing proteolytic enzymes to digest the zona pellucida is the: A.…
A: Introduction Sperm is the male gamete or reproductive cell, in anisogamous forms of sexual…
Q: In protein synthesis, adenine pairs with ________________________, and guanine pairs with…
A: DNA alone cannot account for expression of genes. RNA is needed to help carry out the instruction in…
Q: Write short notes on the following: (a) Neural coordination (b) Forebrain
A: Introduction The nervous system is our body's command center and is the major controlling,…
Q: Cells require O2to serve as a final electron acceptor in the process of cellular respiration, a…
A: Followings options are in serial wise
Q: L. polyrhiza or L. gibba: Which species is the better intraspecific competitor?
A: Intraspecific compitition is a competition between two individuals from the same species.
Q: Describe the role of the proteins involved with DNA replication. Also identify if the protein is…
A: DNA Replication is a process to replicating the dsDNA to form multiple copies of it. DNA…
Q: Explain the following statements in 4-6 lines Humans are living longer, and that increases the risk…
A: Humans live a longer life than many other species. Humans have an average age of about 70 years.…
Q: Name the components of the formed elements in the blood and mention one major function of each of…
A: Body fluids are the liquids that make up the human body. They are also known as bodily fluids or…
Q: Identify the roles of the PCR2 complex in the repression of transcription by HOTAIR.
A: * HOTAIR stands for HOX transcript antisense RNA is a gene which can be found between HOXC11 and…
Q: Which among the following gland produces Insulin, the chief hormone in body for metabolizing sugar?…
A: Insulin is peptide harmone. Insulin helps to regulate blood sugar level in our body.
Q: 1. Analyze the pedigree II II IV V
A: Pedigree analysis is a chart that represents a family tree showing the members of the family who…
Q: 5. In a given population, only the "A" and "B" alleles are present in the ABO system; there are no…
A: The Hardy-Weinberg equilibrium gives us idea about the allele and genotype frequencies in a…
Q: Which among the following gland produces Insulin, the chief hormone in body for metabolizing sugar?…
A: Insulin helps blood sugar enter the body's cells so that it can be used for energy. Insulin also…
Q: In an ethnic population, there is a constant prevalence of familial hypercholesterolemia with…
A: Since you have posted a question with multiple subparts, we will solve first sub part for you. TO…
Q: How do Cyclins work? a. They are kinases that phosphorylate key proteins at different points in the…
A: Cell cycle progression is dependent on the activity of cyclin-CDK complexes. Cyclins are the…
Q: d. A given molecule of ATP can be broken down to ADP + P close to 1500 times in a day ("ATP cycle").…
A: ATP cycle produce energy for cells to do work. ATP is generated and energy is transported to where…
Q: There may be similarities between different species due to a common ancestor. Davao is known for…
A: The diversity of species on The planet is referred to as biodiversity. Biodiversity refers to the…
Q: what is the 6 main basic procedure of genetic engineering?
A: The deliberate introduction of a foreign gene or genes into an organism's genome is known as genetic…
Q: When it comes to avoiding the worst impacts due to climate change, three things are sure: First, the…
A: Mitigation is here understood as involving efforts to cut emissions of global greenhouse gases. In…
Q: Define Glomerular Filtration Rate (GFR)
A: Introduction In this question we will discuss about the Glomerular Filtration Rate
Q: QUESTION 2 p53 is a multifunctional protein. Select the domain, if any, that contains the most -…
A: p53 protein :-
Q: Discuss how the social environment contributes to the worldwide DALYS (disability-adjusted life…
A: The act of consuming food in order to assist the body to strengthen its immunity is known as…
Q: which category (prokaryotic or eukaryotic) would COVID-19 fall under
A: Prokaryote * Prokaryotes are the organisms which lacks a nucleus and other organelles in a cell…
Q: 8. If the frequency of the "green" form of red-green color blindness (due to an X-linked locus) is 5…
A: According to our guideline i will gave you answer only one question... please ask rest of the…
Q: I understand how nuclear factor-kB (NFKB) works in the inflammatory response but what is the…
A: The nuclear factor kappa-light-chain-enhancer of activated B cells or NF-kB family consists of five…
Q: 2. Fill in the diagrams by assuming that each original cell represents a human cell with a diploid…
A: Meiosis is a type of reduction division that occurs in cell during formation of new cells. It…
Q: Female mimicry by males occurs in many species. For example, in the Broadley’s flat lizard…
A: * Mimicry In evolutionary biology is the mechanism of resemblance of an animal between it's and…
Q: What are the food items which are produced by bioprocess engineering?
A: The bioprocess engineers develop and manage equipments and systems which process and distribute food…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- how to identify mutant genes molecularly bytransformationQUESTION 25 What is the most common type of DNA sequence present in eukaryotic genomes? A. Repetitive DNA sequences B. Minisatellites C. Exons of genes encoding proteins D. Introns of genes encoding proteinsQuestion:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCG
- Question : Give an alternative form of CpG methylation, given clear handwritten explaination!Question: Genes A, B, C, and D are on the same chromosome. Consider the data and draw a genetic map: Relationship RF B - D 14% C - D 12% A - D 6% B - C 2% A - B 8%Question:- Viral vectors are not the only method being studied for gene therapy purposes. Which of the following is a nonviral delivery method for gene therapy? a.gene pills b.DNA bound to the surface of liposomes c.electrically stimulating cells to take up DNA d.DNA covered with protein
- Identical twin brothers begin life with identical genomes andepigenomes. How will this circumstance change with age?Suggest how these changes could be used as a forensic tool.Genetics of man question: Provide a brief description of on the SNP for the gene GATA binding protein 3 (GATA3)and as well as the gene .Question 9 Both conservative and replicative transposition result in movement of the transposon; however, only conservative transcription Group of answer choices A. Transfers the transposition to the new location without copying it B. Has transposase that cuts at inverted repeats and target sequences C. Produces a second copy of the transposon sequence D. Inserts the transposon sequence into target sequences
- Question. Rewrite the following sentences after correction. (Subject: Biotechnology) The variation in the length of tandem repeat of microsatellite DNA has serious translational affects as this is due to its coding region. Correct: If one parent has sickle cell anemia and other has carrier genotype than there is 25 % chance that any offspring is carrier. Correct: Sickled WBC block the flow of blood and Calcium as they stick together and caused by frame shift mutation. Correct: The N1303K mutation in the CFTR gene of CF patients is autosomal dominant disorder due to insertion of asparagine at 1303. Correct: If a person RBCs have B surface antigen and it will clump with antigen B such clumping indicates Blood type B. Correct: Indirect ELISA can detect polygenic gene expression. Correct:With regards to this sequence below please answer this quistions 1) What is the format of the sequence below and why 2) What do you understand by a query sequence 3) What is the sequence size of this sequence 4) What is the ID of the sequence and indicate the taxonomic rank of the ID ATGAAAAAACGAAAAGTGTTAATACCATTAATGGCATTGTCTACGATATTAGTTTCAAGCACAGGTAATT TAGAGGTGATTCAGGCAGAAGTTAAACAGGAGAACCGGTTATTAAATGAATCAGAATCAAGTTCCCAGGG GTTACTAGGATACTATTTTAGTGATTTGAATTTTCAAGCACCCATGGTGGTTACCTCTTCTACTACAGGG GATTTATCTATTCCTAGTTCTGATAGAAAATATTCCATCGGAAAACCAATATTTTCAATCTGCTATTTGG TCAGGATTTATCAAAGTTAAGAAGAGTGATGAATATACATTTGCTACTTCCGCTGATAATCATGTAACAA TGTGGGTAGATGACCAACAAGTGATTAATAAAGCTTCTAATTCTAACAAAATCAGATTAGAAAAAGGA AGATTATATCAAATAAAAATTCAATATCAACGAGAAAATCCTACTGAAAAAGGATTGGATTTCAAGTTGT ACTGGACCGATTCTCAAAATAAAAAAGAAGTGATTTCTAGTGATAACTTACAATTGCCAGAATTAAAACA AAAATCTTCGAACTCAAGAAAAAAGCGAAGTACAAGTGTGGACCTACGGTTCCAGACCGTGACAATGAT GGAATCCCTGATTCATTAGAGGTAGAAGGATATACGGTTGATGTCAAAAATAAAAGAACTTTTCTTTCAC…Why mammals genomes are way longer than simple organisms, such as birds and insects, even though the number of genes is not that different?