True/False Question (suggested time - up to 1 minute): The amino acid sequence of a given protein does not necessarily change if there is a mutation in the DNA of the corresponding gene. True False
Q: five steps to solving a genetic problem.
A: Genetics is the branch of science that de las with the study of inheritance of a characters from…
Q: When completing genome sequences, contiguous sequences, or contigs are important intermediates.…
A: * A contig refers to series of overlapping DNA sequences that are used to make physical map which…
Q: Nonstandard Base _____ Often Occurs Between ____ and Anticodons.
A: Non-standard base pairing or Non-canonical base pairing refers to the hydrogen bonding between…
Q: Select TRUE or FALSE for each of the following statements: 1. Only one of the three phosphate groups…
A: Human body is composed of different biomolecules that includes nucleic acids (DNA and RNA) proteins,…
Q: Question: What is the probability that DNA sequence S1 with length 4 is found in DNA sequence S2…
A: Probability is defined as the possibility of getting a desired output with the possible inputs. The…
Q: When referring to the amino acid sequences of proteins, sequence homology is the same as sequence…
A: single mutation leads to a homologous protein, and yet may drastically change the structure and/or…
Q: The enzyme sucrase cleaves the disaccharide sucrose into the monosaccharides glucose and fructose.…
A: INTRODUCTION Hydrolase These are group of enzymes that catalyse the chemical bond breakdown by…
Q: di-deoxy nucleotides terminate DNA elongation in Maxam-gilbert method. True False
A: First-generation DNA sequencing methods include Maxam–Gilbert sequencing and the Sanger method.…
Q: Part I. Answer the following questions in 5 to 7 sentences. 1. What are pentoses? What are the roles…
A: Carbohydrates are also known as hydrates of carbon. They contain elements such as carbon, hydrogen,…
Q: Obtain the self-dotplot of the following sequence to identify repeat region:…
A: There are various alignment tools available at EMBOSS. It is studied under the domain of…
Q: The kind of mutation where one nucleotide is exchanged for another different nucleotide, which may…
A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. DNA is formed of the…
Q: Q. 693 kbps is equals to how many Bps?
A: bps means base pairs. bps also represent bits per second. Base pairs are present in DNA and RNA…
Q: True or False. In a comparison between the DNAs of related organisms such as humans and mice,…
A: Conserved sequences in related organisms are compared by comparing their proteins.
Q: Question 2 What can we most-accurately say about the polypeptide with the primary sequence KNEADING?…
A: The amino acids are classified on the basis of polarity of the side chain into nonpolar and polar.…
Q: What is the survival value of the degeneracy of the genetic code? – Define what degeneracy means and…
A: Please follow step 2 for detailed explanation.
Q: 3. Describe the properties of genetic code?
A: DNA is the genetic material present in the cell. It regulates the expression of organism.
Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 5. Calculate molecular weight (kiloDalton, kD) and calculated pI…
A: Hi! Thanks for your question. As you have posted multiple questions, we are answering the first two…
Q: True or False: there are three different start codons in the genetic code
A: The hereditary code is degenerate for example beyond what one codon can code for a solitary amino…
Q: This question refers to the mRNA sequence below: 5'-AGCUGAUGGGCUGGUGCCGAGAAAGUUAGGUAA-3' What is the…
A: During translation, the mRNA is read in triplets. The incoming tRNA reads the three bases at a time…
Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…
A:
Q: TRNAS do vary in length. True False
A: RNA is ribonucleic acid which is formed from DNA .It is further of three types :- A )rRNA (…
Q: B- True or False: 1) Genes consist of DNA which belongs to the class of nucleic acids 2) The process…
A: Introduction Macromolecules are big, complex molecules that exist colloidally in intercellular…
Q: I keep getting this maked wrong, if you distinguish my mistake and explain to me in a deeper…
A: The translation is the process by which the genetic code encrypted in the mRNA gets converted to…
Q: Give the amino acid sequence with some little explanation please. 5′…
A: Decoding a sequence of bases in mRNA results in the formation of either peptide, polypeptide, or…
Q: Instructions: Provide brief answers to the following questions: 1. How many codons are there in the…
A: Note: As Per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A…
Q: True or False. Each time the genome is replicated, half the newly synthesized DNA is stitched…
A: At the point when a cell divided, it is significant that every daughter cell gets an…
Q: It asks to categorize the possible answers to a component of eukrayotic RNA, eukrayotic DNA or both:
A: DNA and RNA are both the genetic material that expresses the heredity characteristics from…
Q: True or False: All of the letter sequences in DNA code for the production of proteins. __________
A: Deoxyribonucleic acid(DNA) is considered to be the genetic material within the nucleus that gets…
Q: Generally speaking, a nucleotide substitution has more severe consequences than a hucleotide…
A: Mutations can be categorized into base substitution, deletion, addition, and insertion mutation.…
Q: Briefly describe the function of each of the following components of the DNA extraction protocol.…
A: Hi, Thanks For Your Question. 1. Function Of Heat In DNA Extraction : Answer : Heating Aids In The…
Q: Question. Rewrite the following sentences after correction. (Subject: Biotechnology) The variation…
A: Biotechnology is a branch of science which use living organisms it alters or modify the genes and…
Q: Please answer them correctly - Please answer all of them, they are connected. MUTATION Fill in the…
A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…
Q: Question 1: Answer all practice question parts Label the leading and lagging strands below: 3' Label…
A: DNA is a genetic molecule which undergoes replication and is required for protein synthesis.
Q: True
A: Translation:- Is a process of translating the sequence of a messenger RNA[mRNA] molecule to a…
Q: True or False : If a mutation occurs in gene can this can lead to one amino acid change in protein…
A: The DNA is the genetic material that is being transcribed into mRNA and this mRNA is translated into…
Q: A protein produced by bacteria is 300 amino acids long. Compute for the number of nucleotides in the…
A: Proteins are made up of amino acids that are bonded together by peptide bonds. Proteins are…
Q: True or False: In this trial (Hershey And Chase), since labeled viral proteins were found outside…
A: Earlier it was thought that protein was the genetic material which was passed from one generation to…
Q: Number er & Footer Time Info Parts Insert Pictures Header Footer Link to Previous Navigation Show…
A: Introduction The word used to identify the DNA nucleotide bases make up the whole term "Gattaca."…
Q: 1. A nucleoside is composed of Sugar and Nucleic Acid-Base. 2. The Nucleic Acid base in DNA and RNA…
A: Answers are given below,
Q: Between, database search procedure, de novo spectrum identification, tag-based methods, and library…
A: Database search procedure- is a useful method for protein identification. Protein databases posses…
Q: Protocols for analysing DNA
A: *DNA can be analysed through Polymerase chain reaction Short tandem repeat analysis Y chromosome…
Q: This question refers to the mRNA sequence below: 5'-CCGUAUGCAUUUCGGACUUAGUAAGGACUGACAUAA-3' What is…
A: Question - This question refers to the mRNA sequence below: 5-CCGUAUGCAUUUCGGACUUAGUA…
Q: 1. Partner DNA strand 2. the mRNA strand 3. The tRNA 4. the formed amino acids 5. the…
A: Given: 3’ T A C A T G C C G A A T G C C 5’ To find: 1. Partner…
Q: Whole genome sequencing provides the most comprehensive genomic information. Nevertheless, there are…
A: DNA microarrays are a set of DNA probes that are arrayed on a solid platform and used to detect the…
Q: Write out the DNA sequence using the following instructions: This is a double stranded DNA hydrogen…
A: The nucleotides polymers are responsible for determining and regulating the genetic characteristic…
Q: Question:- When researchers test a new drug using two similar groups of mice, the group of mice…
A: In a scientific experiment different steps are followed that includes construction of hypothesis,…
Q: Question 2 Review Bioinformatics. Match the term and its description. Each term can only be used…
A: 1). The entire set of proteins expressed by a cell or group of cells is called as Proteome. It is…
Q: Why is a Dichotomous Key considered arbitrary
A: Introduction The word "dichotomous" refers to splitting into two parts. A dichotomous key is a tool…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- BIOMOLECULES - MULTIPLE CHOICE - Please answer properly QUESTION : The antibody-antigen binding site is different from an active site of an enzyme because an enzyme’s active site. A. contains amino acids without sidechains B. contains modified amino acids C. is complementary to a specific ligand D. catalyzes a chemical reactionSIX - BIOMOLECULES INSTRUCTIONS - Answer the multiple choice and explain why you choose that answer in 3-5 sentences. - Answer the Questions properly. Please do not copy in google.FIVE - BIOMOLECULES INSTRUCTIONS - Answer the multiple choice and explain why you choose that answer in 3-5 sentences. - Answer the Questions properly. Please do not copy in google.
- UPVOTE WILL BE GIVEN! ANSWER IN 3-5 PARAGRAPHS (TYPEWRITTEN) a. What are the applications of modern biology in biochemistry? b. What are the implications of these applications? c. How do you think these applications will change the world in the future?Sequence: AAA UGG CAA Translate the sequence into the correct amino acids. Question 2 options: Lys Trp Stop Lys Trp Gln Stop Lys StopSame sense mutation is usually non-destructive due to the degeneracy of codons. Group of answer choices True False
- Question: Some scientists have concluded that this method of gene therapy will be a more effective long-term treatment for SCD than HSCT. Use all the information provided to evaluate this conclusion. I dont know how to answer this question pls help:(Question 9 Select one answer. Different types of cells in the body have different structures and functions because: A. each cell type makes all of the proteins, but rapidly breaks down the ones it does not need. B. each cell type expresses a different set of genes. C. each cell type contains a different set of genes. D. each cell type has a different combination of chromosomes.not writing assignment!!!!!!!!! could you make powerpoint presentation subtopics for Fluorescent Protein-Based Biosensors and Their Clinical Applications example of what i want is below - just follow the format no need to do it i just need a format for the topic
- True or False : If a mutation occurs in gene can this can lead to one amino acid change in protein which can negatively impact protein function.Just in case, the question is at the very end and please be sure to use serine only.UPVOTE WILL BE GIVEN! ANSWER IN 3-5 PARAGRAPHS (TYPEWRITTEN) a. What are the applications of modern biology in biological membranes? b. What are the implications of these applications? c. How do you think these applications will change the world in the future?