REGULATION OF GENE EXPRESSION Gene Genetic regulatory protelns bind to the DNA and control the rate of transcription. Transcription In attenuation, transcription terminates soon after It has begun due to the formation of a transcriptional terminator. MRNA Translation Translational repressor proteins can bind to the MRNA and prevent translation from starting. Riboswitches can produco an mRNA conformation that provonts translation from starting. Antisense RNA can bind to the MRNA and prevent translation from starting. Protein Posttranslation In feedback Inhibition, the product of a metabolic pathway Inhibits the first enzyme in the pathway. Covalent modifications to the structure of a protoin can altor Its function. Functional protein

REGULATION OF GENE EXPRESSION Gene Genetic regulatory protelns bind to the DNA and control the rate of transcription. Transcription In attenuation, transcription terminates soon after It has begun due to the formation of a transcriptional terminator. MRNA Translation Translational repressor proteins can bind to the MRNA and prevent translation from starting. Riboswitches can produco an mRNA conformation that provonts translation from starting. Antisense RNA can bind to the MRNA and prevent translation from starting. Protein Posttranslation In feedback Inhibition, the product of a metabolic pathway Inhibits the first enzyme in the pathway. Covalent modifications to the structure of a protoin can altor Its function. Functional protein

Name: Discuss the advantages and disadvantages of genetic regulation at the
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Discuss the advantages and disadvantages of genetic regulation at the different points identified. REGULATION OFGENE EXPRESSIONGeneGenetic regulatory protelns bind tothe DNA and control the rate oftranscription.TranscriptionIn attenuation, transcript

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 15SQ

See similar textbooks

Similar questions

The assembly of transcription factors on a promoter begins some 25 nucleotides upstream where it binds to a start _______________ sequence Group of answer choices TAAT ATTA TATA ATGC
Cells go to great length to correctmistakes in the processes of DNAreplication, transcription, splicing,and translation. Are there analogousstrategies to correct mistakes in theselection of which genes are to beexpressed in a given cell type? Couldthe great complexity of transcriptioninitiation in animals and plants reflectsuch a strategy?
34.. heterochromatic regions decondense for gene expression a. pre-transcriptional controlb. transcriptional controlc. translational controld. post-translational control
Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protien
A pre-initation complex (PIC) is required for transcription to begin. State which TFII protein has catalytic function.
Fill in the blanks Enzymes that catalyze RNA-directed DNA synthesis are called ______. A(n)__________ is an enzyme that cleaves DNA at specfic sequences. The large multisubunit complex that links the general transcription factors to the gene-specific transcription factors is called __________.
Which of the following mechanisms may create multiple mRNAsfrom the same gene?a. posttranslational controlb. alternative mRNA splicingc. binding of a transcription factord. chromatin remodelinge. miRNAs
Gene expression is Usually regualated at the initiation of transcription. True False
GGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotype
29. tight packing of previously less condensed chromatin identify which describes the statement above a. pre-transcriptional controlb. transcriptional controlc. translational controld. post-translational control
Mechanisms that govern gene expression do not operate during ___ . a. transcription b. RNA processing c. translation d. knockouts
Draw the mature mRNA molecule (ready fir transport to the cytoplasm) with modifications required fir export. Label all modifications required gor export.