1. Restriction enzymes are extensively used in molecular biology. Below are the recognition sites oftwo of these enzymes, BamHI and Bcll.a) Shown below is a BamHI recognition site, which cleaves after the first G. Does cleavage byBamHI result in a 5' or 3' overhang?5... GGATCC...3'3...CCTAGG...5'b) Shown below is a Bcll recognition site, which cleaves cleaves after the first T. Does cleavage by ,Bcll result in a 5' or 3' overhang?5... TGATCA...3'3'... ACTAGT.. 5'You are given the DNA shown below.5 ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3'3' TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5'c) If the above DNA was cut with BamHI, how many DNA fragments would you expect? Write outthe sequence of these double-stranded fragments.d) If the above DNA was cut with Bcll, how many DNA fragments would you expect? Write out thesequence of these double-stranded fragments.e) If you ligate or join the smaller restriction fragment in step c with the smaller restrictionfragment in step d, what would be the sequence of the resulting recombinant DNA fragment?f) Could you cut this recombinant DNA fragment with either BamH1 or Bcll? Yes or No, explainbriefly.

Restriction Enzyme Restriction enzymes are the enzymes which are used to cut DNA by recognizing the…

Answered: Restriction enzymes are extensively…

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 1CT

See similar textbooks

Similar questions

For Pet41 (choose Pet41 a, b, or c as provided in the image) how would you design the primers (forward and reverse) for the following gene of interest and what restriction enzymes would be used (as shown in the image)? Be sure to explain and elaborate on why selected and how. Gene of Interest: atgggc gacaaaggga 241 cccgagtgtt caagaaggcc agtccaaatg gaaagctcac cgtctacctg ggaaagcggg 301 actttgtgga ccacatcgac ctcgtggacc ctgtggatgg tgtggtcctg gtggatcctg 361 agtatctcaa agagcggaga gtctatgtga cgctgacctg cgccttccgc tatggccggg 421 aggacctgga tgtcctgggc ctgacctttc gcaaggacct gtttgtggcc aacgtacagt 481 cgttcccacc ggcccccgag gacaagaagc ccctgacgcg gctgcaggaa cgcctcatca 541 agaagctggg cgagcacgct taccctttca cctttgagat ccctccaaac cttccatgtt 601 ctgtgacact gcagccgggg cccgaagaca cggggaaggc ttgcggtgtg gactatgaag 661 tcaaagcctt ctgcgcggag aatttggagg agaagatcca caagcggaat tctgtgcgtc 721 tggtcatccg gaaggttcag tatgccccag agaggcctgg cccccagccc acagccgaga 781 ccaccaggca gttcctcatg tcggacaagc ccttgcacct…
A small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis.The following data were obtained. (a) Is the original molecule linear or circular?(b) Draw a map of restriction sites (showing distances between sites) that isconsistent with the data given.(c) How many additional maps are compatible with the data?(d) What would have to be done to locate the cleavage sites unambiguouslywith respect to each other?
Consider the ends of the DNA fragments shown below. They have been produced by digestion of a single sequence of DNA using a number of restriction endonucleases. 1. 5'A 3' 3'TTCGA5' 2. 5'G 3' 3'CAGCT5' 3. 5'AATTC3' 3' G5 4. 5'TCGAC3' 3' G5' 5. 5'GGG 3' 3'CCC 5' Which of these ends are capable of annealing and being joined by DNA ligase?
Although SINES are nonautonomous, they do occasionally move from one genomic site to another. How is this usually achieved? a. Using another TE's insertion sequence b. Using another TE's restriction enzyme c. Using another TE's transposase d. Using another TE's reverse transcriptase
Give the recognition sequences for each of the restriction enzymes (a) PagI, (b) AluI, (c) PstI, and (d) RcaI. Show the sequence in double-stranded DNA (dsDNA) format, indicate the cleavage position with a ^, and mention which types of ends are generated in each case (blunt or sticky; 5’ or 3’ overhang)? Recognition sequence for a)PagI cleaves DNA at the recognition sequence 5' ---T ^CATGA--- 3' b) AluI cleaves DNA at the recognition sequence 5' AG^CT 3' c) PstI cleaves DNA at the recog.
How many fragments would you expect to be formed from digestion of a 2500 base pair long linear piece of DNA using a restriction enzyme with a 5 base pair recognition sequence?”
Refer to the succeeding diagram of two DNA samples (A, B) with the specific restriction enzyme(RE) recognition sites marked with arrows. A spontaneous mutation (insertion) occurred in DNAsample A and introduced an additional restriction site. 1. Design two (2) DNA probes to be used in RFLP analysis involving these two DNA samples.Draw/illustrate the region(s) in the DNA molecule which you will use as reference(homologous) sequences in the design of the probes, THAT -a. Will reveal RFLP polymorphism between the DNA samples after probedetection/visualization; andb. Will not reveal RFLP polymorphism between the DNA samples
a. What is the purpose of molecular cloning?b. What purpose do selectable markers serve in vectors?c. What is the purpose of the origin of replication in aplasmid vector?d. Why do cloning vectors have polylinkers?
1. How would you insert your gene of interest in a target location using CRISPR/Cas9? a. Introduce a plasmid containing the DNA sequence of gene of interest flanked by direct repeats. b. Introduce a plasmid containing the DNA sequence of gene of interest flanked by sequences similar to both sides of the target cut site. c. Introduce a plasmid containing the gRNA of your gene of interest d. Introduce a plasmid containing the DNA sequence of gene of interest flanked by inverted repeats.
1 (a) What do ApR, TcR, and ori on the pBR322 map represent and discuss there individual functions? (b)Does the undigested plasmid show more than a single band when electrophoresed? Why? (c)What other kinds of molecules, in addition to plasmid DNA would you expect to find in a sample of plasmid DNA extraction? (This is not a graded assignment)
After digesting the DNA produced by PCR (generated using the primers mentioned in question 2 added for context below) and the pET-28a vector with restriction enzymes SacI and HindIII, what steps would be needed to obtain a pure culture of E. coli cells that contain the pET-28a-OXA-M290 plasmid (i.e., a culture which consists only of E. coli cells that contain this plasmid)? And, how could you confirm that the OXA-M290 gene was successfully cloned into the pET-28a vector without any mutations? [4 – 8 sentences suggested] Question 2 (Do not answer, just for context):The forward primer that will be designed is the primer that binds to the region of the OXA-M290 gene where the start codon is located, and the reverse primer is the primer that binds to the region of the gene where the stop codon is located. In order to clone the PCR product generated using these primers into pET-28a, extra nucleotides must be added to the 5' ends of the primers. These extra nucleotides will contain the…
Consider a partial restriction digestion, in which genomic DNA is exposed to a small, limiting amount ofa restriction enzyme for a very short period of time.a. Would the resultant fragments be longer or shorteror the same size as those produced by a completedigestion?b. If you prepared genomic DNA from a tissue sample containing millions of cells, would the fragments produced by partial digestion of DNA fromall of these cells be the same or different?

SEE MORE QUESTIONS

Recommended textbooks for you

Biology Today and Tomorrow without Physiology (Mi…

Biology

ISBN:

9781305117396

Author:

Cecie Starr, Christine Evers, Lisa Starr

Publisher:

Cengage Learning