Which of the following set(s) of primers a-d could you use to amplify the following target DNA sequence, which is part of the last protein-coding exon of the CFTR gene? Explain briefly. (Note: The three dots represent the body of the region to be amplified, whose beginning and end are only being shown.) 5' GGCTAAGATCTGAATTTTCCGAG . TTGGGCAATAATGTAGCGCCTT 3' 3' CCGATTCTAGACTTAAAAGGCTC .. AACCCGTTATTACATCGCGGAA 5' a. 5' GGAAAATTCAGATCTTAG 3'; 5' TGGGCAATAATGTAGCGC 3' b. 5' GCTAAGATCTGAATTTTC 3'; 3' ACCCGTTATTACATCGCG 5' c. 3' GATTCTAGACTTAAAGGC 5'; 3' АССCGTTATТАСАТСGCG 5' d. 5' GCTAAGATCTGAATTTTC 3'; 5' TGGGCAATAATGTAGCGC 3'

Which of the following set(s) of primers a-d could you use to amplify the following target DNA sequence, which is part of the last protein-coding exon of the CFTR gene? Explain briefly. (Note: The three dots represent the body of the region to be amplified, whose beginning and end are only being shown.) 5' GGCTAAGATCTGAATTTTCCGAG . TTGGGCAATAATGTAGCGCCTT 3' 3' CCGATTCTAGACTTAAAAGGCTC .. AACCCGTTATTACATCGCGGAA 5' a. 5' GGAAAATTCAGATCTTAG 3'; 5' TGGGCAATAATGTAGCGC 3' b. 5' GCTAAGATCTGAATTTTC 3'; 3' ACCCGTTATTACATCGCG 5' c. 3' GATTCTAGACTTAAAGGC 5'; 3' АССCGTTATТАСАТСGCG 5' d. 5' GCTAAGATCTGAATTTTC 3'; 5' TGGGCAATAATGTAGCGC 3'

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
You are analyzing the region of DNA shown below to determine how many AATG repeats are present. To do so, you must amplify the entire region of AATG repeats. Design primers of 16 bases each so they anneal outside the region of interest. More than one primer pair is possible, but just give one. 5’-ACTGGCACAGAACAGGCACTTAGGAATGAATGAATGAATGAATGAATGAATGACCTGTGTGGTTCCCAGTTCCTCC-3’ 3’-TGACCGTGTCTTGTCCGTGAATCCTTACTTACTTACTTACTTACTTACTTACTGGACACACCAAGGGTCAAGGAGG-5’
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region. 4C. In NOT more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus?
The chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?
Two circular DNA molecules, which we can call molecule A andmolecule B, are topoisomers of each other. When viewed under theelectron microscope, molecule A appears more compact than molecule B. The level of gene transcription is much lower for molecule A. Which of the following three possibilities could accountfor these observations?First possibility: Molecule A has three positive supercoils, andmolecule B has three negative supercoils.Second possibility: Molecule A has four positive supercoils, andmolecule B has one negative supercoil.Third possibility: Molecule A has zero supercoils, and molecule Bhas three negative supercoils.
Consider the following sequence of DNA: 3'-TTA CGG-5'What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?
in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?
the one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
In the following sequence, a cytosine was deaminated and is now a uracil (underlined). 5’-GGTAUTAAGC-3’ a. Which repair pathway(s) could restore this uracil to cytosine? b. If the uracil is not removed before a DNA replication fork passes through, what will be the sequences of the two resulting double helices? Provide the sequences of both strands of both helices. Label the old and new strands and underline the mutation(s). c. Could the mismatch repair pathway fix the mutations you’ve indicated in part b? d. If the cell undergoes mitosis, and the replicated DNAs are distributed into the two daughter cells. Will 0, 1, or 2 daughter cells have a mutation in this sequence?