Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-LEU-LEU-SER DNA Sequence: TTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT Cat Am no Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-LEU-SER-ARG-LEU-LEU.ADO DNA Sequence: CTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Shark Amino Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-VAL-VAL-SER DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGT Colphin Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-ILE-LEU-LEU-SER-ARG-LEU-LEU-ARG DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Lizard Amino Acid Sequence: ISO4SO-ASP-GLN-PHE-ILE-LEU-HIS-SER-ARG-LEU-LEU-ARG DNA Sequence. ATTATCGACCAGTTTATCCTACATTCCCGTCTACTTCGT Sponge Activity Questions: 1. Which organisms are closely related to each other? How are they related? 2. What does this tell us about the organisms and their ancestors? 3. How amino acid sequences and DNA sequences are used to determine relatedness in organisms and classification?

Q: Amino Acid: Asn-Met-Ser-Ile-Phe-Arg-Cys-Tyr-Lys    What is the one letter code of this amino acid…

A: Amino acids are compounds containing carbon, hydrogen, oxygen, and nitrogen. They are the building…

Q: Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains the amino…

A: Amino acids are the simplest unit for the formation of peptides or proteins. They are joined by a…

Q: Identify the nucleotide. CH HN 9. N' O. 0-P-OCH2 O DUMP O dGMP O DAMP O dCMP O dTMP

A: Given below is a structure of nucleotide as it contains a base, sugar & phosphate group. The…

Q: Comparision between neutral amino acid (tyrosine) and cyclic alcohol

A: Amino acids are monomers of protein they are linked with each other by forming peptide…

Q: Protein: Hemoglobin Circle and underline each codon, amino acid sequence, make a mutation of the 3rd…

A: Here the not cleared the mutation type, are point mutations, frame shift mutation, addition mutation…

Q: After the polypeptide shown below was treated with maleic anhydride, it was hydrolyzed by trypsin.…

A: The following polypeptide is considered:…

Q: Write the structure of each of the following peptides. Start with the N-terminal and the COO- on the…

A: Peptides are the sequence of amino acids that are joined through formation of peptide bond. The…

Q: CH3CO-ETATKAELLAKYEATHK-CONH2 4. A polypeptide comprised of 17 amino acid res- idues with the…

A: Polypeptide: These are chains of amino acids with peptide bonds that connect them. Dehydration of…

Q: The PEPTIDE shown has the amino acid sequence: Lys-Glu-lle-Ser-Val Val-Asp-lle-Glu-Arg…

A: A linear sequence of amino acids forms the primary structure of a protein molecule. The major…

Q: A sample of a peptide of unknown sequencewas treated with trypsin; another sample of the same…

A: Introduction: The chain of amino acids is known as a peptide which is connected by an amine or…

Q: fof NH HO-P-O-P-O-F `NH2 ÓH ÓH OH OH OH Which nucleotide is shown in the picture above?

A: A nucleotide is a molecule that is organic, containing a nucleoside and a phosphate. It is the basic…

Q: D-Galactose.

A: ''Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: The genetic disorder sickle-cell anemia occurs when the amino acid valine takes the place of…

A: Sickle cell anemia is a type of blood related disorder which is also known known as sickle cell…

Q: Cut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are…

A: Protein sequencing is an important aspect in the field of proteomics and molecular biology which…

Q: Leu-Trp-Phe-Met-Ala-Ile-Val-   Draw the structure of the peptide at pH7.4.   and   Indicate…

A: In the endoplasmic reticulum process of protein folding occurs and it is a very important…

Q: Show where trypsin and chymotrypsin would cleave the following peptide…

A: Amino acids are joined together by a peptide bond to form a polypeptide chain called protein.…

Q: Two amino acids are each specified only by a single triplet. Identify these two amino acids and the…

A: A specific sequence of three consecutive nucleotides that is part of the genetic code and that…

Q: 102 LEU LEU LEU LEU LEU VAL VAL 116 GLY GLY GLY GLY GLY GLY ASN ASN ASN ASN ASN ASN VAL VAL VAL VAL…

A: The changes in amino-acids sequence of the various show the ancestry among the…

Q: Pyrrolysine (Pyl, O) and Selenocysteine (Sec, U) are two uncommon amino acids. Knowing that these…

A: Amino acids are monomers that make up proteins. 20 different amino acids are commonly found in…

Q: B-D-2-Deoxyribose is an aldopentose component of the nucleic acid structure with its -OH grou at C-3…

A: Ribose and deoxyribose are the fundamental building blocks of nucleic acids.

Q: D-Erythrulose in cyclic form:

A: Erythrulose is chemically teterose carbohydrates.formula for erythrulose is C4H8O4. It is used in…

Q: HO, NH2 HO This amino acid is called It's three-letter abbreviation is and its one-letter…

A: Proteins are the building blocks, made up of amino acids. They are of twenty different types that…

Q: Give the amino acid sequence with some little explanation please.   5′…

A: Decoding a sequence of bases in mRNA results in the formation of either peptide, polypeptide, or…

Q: Name the peptide * он H,'N-CH-C-N-CH-C-N-CH-C-O CH, CH-CH, CH, H он H. CH, CH, CH, SH CH,…

A: Peptides are composed of amino acids linked to each other via a peptide bond. Peptides are named…

Q: Pro-Ser-Ala-Phe-Glu. Draw this peptide at pH 7 and include its stereochemistry.

A: Proteins are one of the most important macromolecules. They form the building blocks of all…

Q: Uracil (U Adenine HN 3 H- HO-P-0-P~0-P 0-CH, o-P H H. H H. 5 H OH OH он он 2 O-a-or O-a-or O-a-Or

A: Nucleic acid was first discovered by Fredrich Miescher from the nuclei of the pus cells (leukocytes)…

Q: The following sequence of amino acids are part of adult hemoglobin from the N-terminus. Draw the…

A: Amino acids are the molecules that join to form a protein structure. The bond formed between two…

Q: TNIS IS the SC TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT Write the amino acid sequence of the protein that…

A: Here DNA sequence is given is TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT This DNA strand work as a template…

Q: .Ala-Phe-Lys-Val-Val-Glu rom the above polypeptide, what amino acid/s go/goes inside the cell after…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: Two melanocyte-stimulating hormones have the following amino acid sequences. Take a highlighter or…

A: Conserved sequences are the amino acid sequence that remain identical between two or more species…

Q: Second letter C UUU Phe UCU) UCC UGU UAU1 Tyr UAC S U UUC U UUA L UUG J Ser UGCCYS UAA Stop UGA Stop…

A: tRNA is an amino acid acceptor which carries the amino acid corresponding to the code present in the…

Q: A number of fragments that will be formed by cleaving the peptide Met-Ala-Lys-Met-Arg-Phe-Met-An by…

A: Proteins are one of the macromolecules present in the body. They provide structural support,…

Q: The primary structure of b-endorphin, a peptide containing 31 amino acids synthesized by the body to…

A: There are few agents that can digest the polypeptide chain.

Q: The full name of this amino acid is The 3-letter abbreviation is Please also note the following: •…

A: Amino acids are biomolecules composed of a central carbon bonded to 4 groups. 3 out of these 4…

Q: Given the polypeptide chain below: Ala-Arg-Val-His-Asp-Gln 1. What kind of polypeptide is it? 2.…

A: The organic molecule is comprised of two functional groups that are an amino group and the carboxyl…

Q: Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3' O…

A: Answer :-                             Met-ala-phe-lys-stop                  DNA…

Q: Drew the peptide sequence and write its full name Cys-Gln-Lys-His-Ala-Ser-Gln

A: All the amino acids mentioned in the question are linked Together by peptide bonds that is CONH. A…

Q: The melanocyte-stimulating hormone a-melanotropin has the following sequence:…

A: Aminoacids are the building blocks of proteins that are linked by peptide bond. The sequence of…

Q: Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains the amino…

A: Proteins are composed of amino acids. They are linked together by peptide linkages. Proteins have…

Q: Suggest which part of this sequence belongs to the inner part of the protein and which to the outer…

A: Proteins are polypeptides formed of monomeric units-amino acids. There are 20 different amino acids…

Q: PROTEIN AMINO ACID SEQUENCE Methionine –Threonine – Cystine – Glycine Methionine Methionine Glycine…

A: Proteins are biopolymers that are made up of polypeptide chains of the monomeric units amino acids…

Q: Draw the peptide formed between asparagine and histidine. H,N-CH-ċ-OH H,N- -CH—С—он CH2 ČH2 N° NH2…

A: Introduction: Proteins are one of the major macromolecules that helps in the structure and function…

Q: The primary structure of b-endorphin, a peptide containing 31 amino acids synthesized by the body to…

A: Trypsin is a serine protease that is present in the digestive system of vertebrates. It is an…

Q: UCAQ UC AG UGA0 UC UCAG GUC UOPO AC Alanine Tyrosine Stop A GU Valine Y Cysteine G A Stop AG AC A G…

A: Genetic Code The genetic code is the relationship between the sequence of basis in DNA or its mRNA…

Q: In the peptide Ser-Cys-Ala-Gly, the N-terminal end is glycine. O cystein. O serine. Oalanine.

A: A peptide is a chain of amino acids, in which the individual amino acids are linked together through…

Q: The translated peptide chain is: Asn-Ser-Arg-Gin. What is the name of the protein?(use lowercase…

A: The Translated peptide is Asn-Ser-Arg-Gln is a tetra-peptide

Q: You are analyzing the peptide ala-ile-glu-lys-phe-val- tyr-cys. If you treat the peptide with…

A: Proteins or peptides are a linear chain of amino acids attached together via peptide bonds. Natural…

Q: Spell out the name of the polypeptide using three letter codes for each amino acid separated with…

A: Phenyl isothiocynate is the Edman reagent. It reacts with N-terminal amino acid to give phenyl…

Proteins

We generally tend to think of proteins only from a dietary lens, as a component of what we eat. However, they are among the most important and abundant organic macromolecules in the human body, with diverse structures and functions. Every cell contains thousands and thousands of proteins, each with specific functions. Some help in the formation of cellular membrane or walls, some help the cell to move, others act as messages or signals and flow seamlessly from one cell to another, carrying information.  

Protein Expression

The method by which living organisms synthesize proteins and further modify and regulate them is called protein expression. Protein expression plays a significant role in several types of research and is highly utilized in molecular biology, biochemistry, and protein research laboratories.