Select all TRUE statements related to the process of transcription. More than one answer is possible. The enzyme helicase separates the complimentary base pairs that hold double-stranded DNA together. MRNA is formed by joining ribonucleotides that pair with the template strand of DNA MRNA is formed by joining ribonucleotides that pair with the coding strand of DNA exons are removed from MRNA. Okazaki fragments form on the lagging strand. introns are removed from MRNA. The enzyme DNA gyrase encompasses both strands of DNA and uncoils the helix of double-stranded DNA. transcription is the process by which MRNA codons are translated to proteins. MRNA formed will be complimentary to the coding strand. DNA is unwound to expose the targeted gene

Select all TRUE statements related to the process of transcription. More than one answer is possible. The enzyme helicase separates the complimentary base pairs that hold double-stranded DNA together. MRNA is formed by joining ribonucleotides that pair with the template strand of DNA MRNA is formed by joining ribonucleotides that pair with the coding strand of DNA exons are removed from MRNA. Okazaki fragments form on the lagging strand. introns are removed from MRNA. The enzyme DNA gyrase encompasses both strands of DNA and uncoils the helix of double-stranded DNA. transcription is the process by which MRNA codons are translated to proteins. MRNA formed will be complimentary to the coding strand. DNA is unwound to expose the targeted gene

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 4QP: If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA...

See similar textbooks

Similar questions

Indicate which of the following items are associated with transcription or translation. This could be in prokaryotes or eukaryotes, or both. Group of answer choices: Translation OR Transcription Sigma binds to the promoter mRNA binds to the small ribosomal subunit Spliceosomes remove introns and splice together exons Nucleotides are added from the 5' to 3' end tRNA anticodon binds to the corresponding mRNA codon STOP codon results in termination
Refer to the double stranded DNA molecule with the sequence below to answer the following questions: 5’ATATGGGTCTCGATAGGGCTGTTTTCTCCGGC 3’ 3’TATACCCAGAGCTATCCCGACAAAAGAGGCCG 5’ Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript and polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. DNA strand: mRNA: amino acid sequence:
When summarizing the process of transcription in a cell as a gene is used to build a polypeptide, which of these statements accurately reflects the process of transcription? Choose ALL that apply. A - An mRNA molecule is produced in the nucleus of the cell. B - A polypeptide is synthesized based on the sequence of nucleotides on the tRNA molecule. C - The RNA molecules contains three nucleotides in a row whose bases form a codon. D - The ribosome attaches to the DNA to build a polypeptide. E - The resulting RNA molecule is a complement of the gene on the DNA.
Gene Expression: Illustrate some steps involved in RNA processing and identify the sequence of amino acids in a polypeptide chain corresponding to the codons in the mRNA. Procedure and Questions: The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. 1. Indicate the 3’ and 5’ ends of both strands. G C T A T A A T G G C A a a a t t g G G T C A G G C A a a t c g a C A T A G C T G A C G G g g a t g a G G T T A A C G A T A T T A C C G T t t t a a c C C A G T C C G T t t a g c t G T A T C G A C T G C C c c t a c t C C A A T T 2. Write the pre-mRNA molecule. Indicate the 3’ and 5’ ends. 3. Write the mRNA molecule. Indicate the 3’ and 5’ ends. 4. Write the tRNA anticodons corresponding to the codons in the mRNA. 5. Write the sequence of amino acids in the resulting polypeptide
Which of the following statements regarding complementary molecules in transcription is false? Group of answer choices The sense strand is complementary to the template strand The transcribed RNA is complementary to the noncoding strand The coding strand is complementary to the antisense strand The transcribed RNA is complementary to the coding strand
Listed below are steps in the transcription process. Reorganize the list so the steps in the correct order- starting with the first step in initiating transcription and ending with completion of a new strand of RNA (in other words- from start to finish of transcription). RNA polymerase reaches the termination signal DNA unwinds underneath RNA polymerase at transcription start site RNA polymerase is recruited to the promoter region mRNA transcript is released General Transcription factors bind TATA box (and other DNA sequences) in the promoter region General Transcription Factors unbind from promoter region mRNA transcript synthesis occurs RNA polymerase moves along the template strand in the 3’ to 5’ direction
Select the most complete list of correct structures involved in the process of transcription a. mRNA, amino acids, ribosomes, polypeptide chains b. DNA, mRNA, RNA polymerase, a promoter c. mRNA, polypeptide chains, RNA polymerase d. DNA, mRNA, amino acids
Match the statement that corresponds to the specific type of transcription and translation. Choices: Eukaryotic Translation Prokaryotic Translation and Transcription Both Prokaryotic and Eukaryotic Transcription Prokaryotic Transcription Prokaryotic Translation Both Prokaryotic and Eukaryotic Translation Eukaryotic Transcription 1. RF1 and RF2 recognize the three bases to terminate the process 2. TATA box in the promoter region 3. single mRNA codes for the proteome 4. methionine is removed 5. simultaneous and rapid process producing mRNA and polypeptide 6. eRF recognizes UGA 7. dozen of initiation factors involving methionyl tRNA * 8. rho factor and sequence of uracil in a loop conclude the process 9. ribosome propels to the next bases 10. sigma factor binds to RNA polymerase in the promoter region 11. regulating elements in the operon 12. cleaving the polypeptide by adding water 13. removal of gene segment disrupting the message 14. CAAT box is found 80 nucleotides from the…
in transcription, if the gene to be transcribed is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the newly synthesized RNA strand? Write the sequence from 5’ to 3’. What is the sequence of the template DNA strand? Write the sequence from 5’ to 3’.
Which of the following are features of transcription? -there is a direct interaction between nucleotides in the template DNA strand and incoming nucleotides being joined at the growing end of the RNA chain. -the RNA product remains permanently hydrogen-bonded to the template DNA strand. -the RNA being produced is elongated by addition of nucleotides at its 5' end. -the template DNA strand is "read" by RNA polymerase in a 3'-to-5' direction. -the site at which transcription starts is called the replication origin. More than one answer is right Please help me I’m confused
Consider this list (below) of steps involved in transcription. These steps are out of order. TRANSCRIPTION: 1. mRNA travels through a nuclear pore and enters the cytoplasm 2. the mRNA polymerase attaches at the start of a specific gene 3. RNA polymerase reads the gene surface4. a transcription factor bonds to a promoter site5. DNA molecule is unwound 6. a complimentary mRNA is produced What is the correct order of this transcription?
Which of the following are steps of transcription? Select all that apply. a.RNA polymerase assembles a strand of mRNA complementary to the noncoding strand of DNA. b.RNA polymerase binds to a gene’s promoter. c.RNA polymerase assembles a strand of mRNA complementary to the coding strand of DNA. d.RNA polymerase moves over the gene and unzips the double helix to form a “transcription bubble.”