Transcribe the following DNA molecule into mRNA. Make sure to find the start codon to begin your transcription and look for the stop codon to end it. Highlight both the START and STOP codons: DNA G C T A C G G A A T T C mRNA

Transcribe the following DNA molecule into mRNA. Make sure to find the start codon to begin your transcription and look for the stop codon to end it. Highlight both the START and STOP codons: DNA G C T A C G G A A T T C mRNA

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 4TYU: The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA...

See similar textbooks

Related questions

Q: How many different mRNA sequences can encode a polypeptide chain with the amino acid sequence…

A: Polypeptide chain includes a sequence of amino acids that are coded by different codons during the…

Q: Which of the following is NOT an event associated with translation termination? A stop codon…

A: Hi, Thanks For Your Question. Answer : Correct Option Is A terminal amino acid is added to the…

Q: 1. What is a codon? 2. For eaxh of the following mRNA codons, give the tRNA anticodon and determine…

A: Central dogma of cell comprises of two important processes. They are transcription of DNA into mRNA…

Q: Which of the following could be the mRNA codon, the codon on the DNA sense strand, and the codon on…

A: DNA => Transcription => mRNA => Translation => Protein. In DNA: 5' - 3' strand is called…

Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…

A: Hi, Thanks For Your Question. Answer : Let's Learn Some Basic Concepts First: Transcription : It Is…

Q: What stops the translation process? when a stop codon on the mRNA enters the A site when a stop…

A: There are three types of stop codons which are present in m RNA and when they are encountered the…

Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…

A: The proteins are the final end product of a gene that ultimately determine the characteristics of an…

Q: Consider this list (below) of steps involved in translation. These steps are out of order.…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum generate…

Q: describe the process of reading a gene and turning it into a protein in a eukaryote.Your first…

A: Transcription: The process of conversion of segment of the DNA to RNA is called as Transcription.…

Q: A DNA sense strand contains the following nucleotide base sequence: TAC AGC AAT CAC From this,…

A: Sense strand is a coding strand that does not code for mRNA. Complementary base pairing occurs in…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Mutation is the sudden change in the base pair of sequence resulting in altered phenotype. The…

Q: Indicate which of the following items are associated with transcription or translation. This could…

Q: DNA A G T A C C G G G C A A A C T G C A T T G T G mRNA U C A U G G C C C G U…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…

A: Transcription is the process that synthesizes mRNA from DNA. The mRNA strand synthesized through…

Q: Here is a DNA sequence that codes for an extremely short protein. 3' TТАССТССССАТССАА 5' template…

A: DNA acts as the template for mRNA synthesis. The mRNA has the same sequence as the coding strand of…

Q: What will be the sequence of mRNA produced by the following stretch of DNA? 3' ATCGGTTAAC 5'…

A: Transcription is the process of synthesis of an RNA molecule from the DNA template strand. Where RNA…

Q: The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that…

A: The genetic framework is a collection of instructions used by living cells to decipher data encoded…

Q: Which of the following best describes the initiation of translation? A. The mRNA binds the large…

Q: A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1.…

A: Translation or protein synthesis is the third major step of the central dogma of life. mRNA…

Q: Which of the following statements about the translation process is correct? a. RNA is made…

A: Gene expression is the process by which a gene is turned on in a cell to make RNA and proteins. It…

Q: if the following DNA sequence were transcribed, which of the following describes the output of this…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Original DNA sequence : T A C A C C T T G G C G A C G A C T Amino acid sequence? Mutated DNA…

A: The proteins are produced from the mRNA sequence by translation process that occurs within the…

Q: After transcription has been completed in eukaryotes, the mRNA molecule first goes through some…

A: Nucleus is main controller of the cell which carries genetic instructions . It contain thread like…

Q: All of the following are true about translation EXCEPT _____. as the ribosome moves from codon…

A: Answer :- All of the following are true about translation except - Ribosomal subunits and a…

Q: When examining the genetic code, it is apparent that ________. there are 44 stop codons…

A: The process of polypeptide chain synthesis or protein synthesis is known as translation. By this…

Q: The following sequence is the coding strand of a piece of DNA. Type out the corresponding template…

A: The protein sequence can be decoded by a coding or template DNA given. The mRNA strand is the same…

Q: Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as…

A: Let's rearrange the mRNA in the codes of three. ACG UCC AAU GGC AGU GAU UUG AAU CCA ACG codes for…

Q: Transcribe the following DNA sequence. Then translate the resulting mRNA transcript.…

A: Mutation is any change in the DNA sequence. It can alter the protein sequence because the proteins…

Q: You are searching the sequence of a coding strand of DNA. What kinds of sequences would help you…

A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…

Q: You’re working in Marshall Nirenberg’s lab, trying to decipher the genetic code. You use several…

A: Marshall Nirenberg studied the genetic codes for protein synthesis in his biochemical research. He…

Q: Which of the following is TRUE in translation? A. Amino acyl TRNA containing one amino acid is…

A: The translation is the process by which amino acids chain or polypeptide chain is produced from the…

Q: If the following changes occurred in the gene, identify the type of mutation and how it would affect…

A: Codon is a triple of nucleotide base pair. Any change in the sequence resulting in altered phenotype…

Q: A gene is a piece of DNA that codes for a protein. Genes are transcribed into mRNA and are on the…

A: Sometimes mutation disrupts protein synthesis by substitution, deletion, or insertion of one or more…

Q: A section of an mRNA has the following nucleotide sequence: GCA GCU UGC CAG For the mRNA sequence…

A: In the question, we are given with mRNA sequence. mRNA is a sequence of ribonucleotides synthesized…

Q: following is a series of DNA triplets. first, transcribe the correct complementary sequence of mRNA…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: In the initiation of translation, the process always lines up at the start codon. What is the start…

A: Translation refers to the process of polymerization of amino acids to form a polypeptide. The order…

Q: Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA Which…

A: According to the central dogma of life, DNA replicates to form copies of itself. DNA acts as a…

Q: The following DNA strand is bound to transcription and translation. Give the translated 5-letter…

A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotide…

Q: For the codon sequence : 5’ GGA – AUA – UGG – UUC – CUA – 3’…

A: The translation is the process in which proteins are synthesized from the RNA. The ribosome and tRNA…

Q: Why are 3 nucleotides needed for a codon? Because one nucleotide is redundant Because…

A: There are five nitrogen bases - adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U).…

Q: The exon and intron sequences

A: The correct option is: 1. The exon and intron sequences

Q: Select all TRUE statements related to the process of transcription. More than one answer is…

A: Note: The given statements are numbered from 1 to 10 for convenience. Transcription occurs in the…

Q: A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon…

A: ANSWER;- 3'UCA 5' Explain;- Transcription is a process of a particular DNA sequence being copied…

Q: the coding strand of DNA has the same sequence as the mRNA, except that there are U’s in the mRNA…

A: an delete the 'C' at position 52 Explanation: it is the type of frameshift deletion mutation…

Q: Which of the following mRNA codons signals the start of translation in eukaryotic cells? 5’-UGA-3’…

A: There are 3 stop codons: UAG(Amber) UAA(ochre) UGA(umber) These codons signal the termination of…

Q: Provided below are strands of DNA. The first one has been done for you. First transcribe the code…

A: Answer: CENTRAL DOGMA = It is the complete process of replication of DNA , transcription of RNA ,…

Q: AAC (DNA TRIPLET) = _______(mRNA CODON) = _________ AMINO ACID 2. TCG (DNA TRIPLET) = _______ (mRNA…

A: Transcription:- process of conversion of DNA to mRNA. Translation:- process of conversion of mRNA…

Q: What is the correct sequence in translation?

A: 1. Translation is the process of synthesis of protein from a transcribed mRNA. Translation…

Question

Transcribe the following DNA molecule into mRNA. Make sure to find the start codon to begin your transcription and look for the stop codon to end it. Highlight both the START and STOP codons:

DNA

mRNA

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. five
The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNA
What is the complementary DNA sequence to the following DNA sequence? ATGCCATCG ____________________________ Write the mRNA codon sequence for the following DNA sequence. CTGCACTGA ____________________________ Write the anticodon tRNA sequence for the following mRNA sequence. UACGACUAG ____________________________ Name the amino acids that use the following mRNA codons. CAU ______________________________ AUG ______________________________ AAG ______________________________ CCC ______________________________ Name the amino acids that use the following DNA codons TAT ______________________________ CGA ______________________________ List the amino acid sequence for the following mRNA code. Be sure that you start with the first start codon you get to and then proceed to list the amino acids until you get to a stop codon. CGUAUGACUGGAAUACUUUAGCCAGCU __________________________________________________________________
Label the 5’ and 3’ untranslated regions and the start and stop codons on your mRNA.
The RNA sequence below encodes a very short protein: 5’ ACCGUACGACCAUGUCCCACUAUCCCUAGGCGAUC 3’ Circle the codon where translation (protein synthesis) by the ribosome will start. Put a box around the codon where it will stop. Use the genetic code table in your text to decode this message: what will be the sequence of amino acids in the protein?
Here is your sequence of DNA to use to do transcription, and then translation: TACAGTCCGGAATTCGCACTTGGGTATATC
Identify the middle, end and beginning sequence. Use your knowledge of start and stop codons to figure it out. Remove codons 24 to 66, including codon 66.
A small section of mRNA codons has the following sequence:UGG GAA ACC UUC Some Amino Acids Aspartate Glutamate Glutamine Isoleucine Threonine Methionine Asparagine Tryptophan Phenylalanine The amino acids listed above that are coded by the mRNA codons are Answer, Answer, Answer, and Answer.Record your answer in order from left to right codons.
Using the mRNA codon table below and your knowledge of transcription and translation, complete this information: DNA Sequence: 5' ATG GAA 3' non-template strand DNA Sequence: 3' TAC ATA 5' mRNA sequence 5' 3' amino acid sequence: Met C
In each problem the DNA Triplet code is given. Determine the mRNA codon using base pairing and write the mRNA CODON into the blank. Using the mRNA CODON you identify in each problem and using the amino acid chart on the next page, identify the corresponding 3-letter amino acid (abbreviation) to place in each amino acid blank. 1. AAC (DNA TRIPLET) = _______(mRNA CODON) = _________ AMINO ACID2. TCG (DNA TRIPLET) = _______ (mRNA CODON) = _________AMINO ACID3. CTT (DNA TRIPLET) = _______ (mRNA CODON) = _________ AMINO ACID 4. GGT (DNA TRIPLET) = _______ (mRNA CODON) = _________ AMINO ACID
What are the functional consequences of this deletion for lilP mRNA transcription and translation? Motivate your answer (100 words max.)