Sequencing Number the steps of DNA replication in the correct order 1 being the first & 5 for the last procedure. 21. DNA unwinds 22. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. 23. The DNA double helix breaks or unzips down the middle between the base pairs. 24. A complementary strand is created for each of the two strands of the original double helix. 25. Two new identical DNA molecules have been produced.

Sequencing Number the steps of DNA replication in the correct order 1 being the first & 5 for the last procedure. 21. DNA unwinds 22. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. 23. The DNA double helix breaks or unzips down the middle between the base pairs. 24. A complementary strand is created for each of the two strands of the original double helix. 25. Two new identical DNA molecules have been produced.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

A biochemist isolates, purifies, and combines in a test tubea variety of molecules needed for DNA replication. Whenshe adds some DNA to the mixture, replication occurs, buteach DNA molecule consists of a normal strand paired withnumerous segments of DNA a few hundred nucleotides long.What has she probably left out of the mixture?(A) DNA polymerase(B) DNA ligase(C) Okazaki fragments(D) primase
A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…
Replication. Complete the table by writing the sequence of the complementary strand. Strand 1 3’ END TTG CTT CAC CTT GCG CGC CCG CGC TAA TTG 5’ END STRAND 2
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH
What enzyme proofreads the DNA molecule? Group of answer choices DNA gyrase DNA polymerase I DNA helicase DNA polymerase III
Polymerases work is to add 10 nucleotides to a DNA strand before dissociating. During replication process, DNA pol III can add tens of thousands of nucleotides at a moving fork. How this additionaccomplished?
Select the characteristics/descriptions of DNA polymerase. Select ALL that apply requires a primer adds nucleotides to 3' end of DNA strand adds nucleotides to 5' end of DNA strand does not require primer has 3'-to-5' exonuclease activity that allows "proofreading" of DNA strand being made
A biochemist isolates, purifies and combines ina test tube a variety of molecules needed for DNA replication. When she adds some DNA to the mixture, replication occurs, but each DNA molecule consists of a normal strand paired with numerous segments of DNA a few hundred nucleotides long. What has she probably left out of the mixture? a.DNA polymerase b. DNA ligase c. Okajaki fragments d. primase
A portion of one strand of DNA has the sequence 5′ AATGGCTTA 3′. If this strand is used as a template for DNA replication, write the sequence of the newly synthesized strand in the direction from left to right in which it will be synthesized.
DIRECTION: SEQUENCING: PLACE THE STEPS OF DNA REPLICATION IN THE CORRECT ORDER a. DNA Polymerase adds nucleotides in the 5' to 3' direction.b. Replication fork is formedc. DNA polymerase attaches to the primer.d. Okazaki fragments are bound together by ligase.e. DNA helicase unwinds DNA
Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
A student mixes various molecule needed for DNA replication. When he adds DNA, replication occurs, but each DNA duplex consists of a normal DNA strand paired with numerous segments of DNA a few hundred nucleotides long. What has been left out of the mixture? A. NTPs B. DNA polymerase III C. ATP D. DNA polymerase I E. DNA ligase