Given a part of DNA undergoing replication. Copy and write the . CTGATTCCGAA TG5 corresponding bases in the new strands. Put an arrowhead in the appropriate end of each new strand to illustrate the direction of growth. . GACTAAGGCTTAG . CTGATICCGAATGS NEW STRANDS (Fill in the correct bases and supply arrowheads.)

Given a part of DNA undergoing replication. Copy and write the . CTGATTCCGAA TG5 corresponding bases in the new strands. Put an arrowhead in the appropriate end of each new strand to illustrate the direction of growth. . GACTAAGGCTTAG . CTGATICCGAATGS NEW STRANDS (Fill in the correct bases and supply arrowheads.)

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 4TYK: Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand...

See similar textbooks

Similar questions

Which of the following is not a true statement comparing prokaryotic and eukaryotic DNA replication? Both eukaryotic and prokaryotic DNA polymerases build off RNA primers made by primase Eukaryotic DNA replication requires multiple replication forks, while prokaryotic replication uses a single origin to rapidly replicate the entire genome DNA replication always occurs in the nucleus Eukaryotic DNA replication involves more polymerases than prokaryotic replication.
The initial mechanism for repairing nucleotide errors in DNA is. mismatch repair DNA polymerase proofreading nucleotide excision repair thymine dimers
Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand is from 39 to 59. b. Synthesis of the new DNA strand is from 59 to 39. c. DNA unwinds, primase adds RNA primer, and DNApolymerases synthesize the new strand and remove the RNAprimer. d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite directionfrom the direction in which the replication fork moves.
How does the double helix structure of DNA support its role in encoding the genome? The sugar-phosphate backbone provides a template for DNA replication tRNA pairing with the template strand creates proteins encoded by the genome Complementary base pairing creates a very stable structure Complementary base pairing allows for easy editing of both strands of DNA.
Which of the following components is not involved during the formation of the replication fork? single-strand binding proteins helicase origin of replication ligase
Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
Which of the following phases is characterized by preparation for DNA synthesis? G0 G1 G2 S
22. A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a template for DNA replication, which of the following correctly depicts the sequence of the newly synthesized strand in the direction in which it will be synthesized? Group of answer choices 1. 5' TTACCGAAT 3' 2. 3′ TTACCGAAT 5′ 3. 5′ TAAGCCATT 3′ 4. 3′ AATGGCTTA 5′
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
5' ATTTACGTTTT 3' 3' TAAATGCAAAA 5' Need help drawing a diagram showing the replication fork at the beginning of the ORI that includes the leading strands, lagging strands, snd the Okazaki fragments of the ORI template
4) Replication of a circular DNA molecule can occur by either theta replication or by rolling circle replication. Describe or explain three differences between these two modes of DNA replication (you must accurately describe the differences between the two - an accurate statement about one form of replication that does not clearly indicate how the other form differs will not answer the qestion in it's entirety).
This is the original strand of DNA: ATG AAG TTT GGC TAA - what would represent a frameshift mutation due to deletion during replication ?