Answered: Sequential binding of RNA polymerase…

Name: 88Sequential binding of RNA polymerase II-TFIIF complex, TFIIE, and TF
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 88Sequential binding of RNA polymerase II-TFIIF complex, TFIIE, and TFIIH completes ___________________ formation.A.pre-initiation complexb.TF recognition elementc.pre-elongation complexD.TATA binding complex89Which of the following is the GDP-GTP ex

Science

Biology

Sequential binding of RNA polymerase II-TFIIF complex, TFIIE, and TFIIH completes ___________________ formation. A. pre-initiation complex b. TF recognition element

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter16: Regulation Of Gene Expression

Section: Chapter Questions

Problem 3TYK

See similar textbooks

Similar questions

Consider a mutation in -10 BOX promoter consensus sequence (TATAAT) in the prokaryote recA gene where the first T base mutated to G, what outcome(s) are likely? a. transcription levels will increase as the GC content would increase b. this mutation is silent, so no change in transcription level c. transcription levels would decrease because the promoter would be weaker d. transcription levels do not depend on the promoter sequence for the gal gene e. nothing would happen because the promoter would not change the mRNA sequence
Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair
The “domain-swapping” experiment that grafts the Gal4 DNA-binding domain to the LexA activation domain generates a chimeric protein that will: A) bind to the Gal4 site. B) bindto the LexA site. C) activate transcription of the LexA gene. D) activate transcription of alleukaryotic genes. E) All of the answer options are correct.
Your investors are concerned that the GasP protein might not be sufficiently produced under normal laboratory conditions. They suggest controlling the transcription of the gasP gene using a chemical that will “trigger” its transcription. a. What type of promoter could be used? b. What chemical will you use to control transcription? c. How does this method of control work?
1. Transcription: a)State the role of RNA polymerase in gene transcription.b. Explain why the DNA is not used directly for protein translation (i.e., why is mRNA used instead?).c. Explain what occurs when a gene’s promoter region is open for RNA polymerase binding.d. Explain what occurs when a gene’s promoter regions is blocked from binding RNA polymerase.e. Explain how two cells, such as liver cells and skin cells, can become specialized in structure and function despite containing the same genome.
There is Hyaluronic acid synthesis occuring in Group X Strep and it is controlled by an operon with 3 genes, called hasXYZ. Based on the 3-line diagram model, a. How many ribosome binding sites are there for the protein? b. How many promoters are there for the genes? c. How many start codons are there for the protein? d. How many RNA Polymerase binding locations are there for the genes? e. How many proteins will be fully functional? f. How many mRNA strands are made?
Histone deacetylase (HDAC) enzymes a.Promote initiation of translation. b.Complex with hyperphosphorylated pRb. c.Repress E2F family activity. d.Add acetyl groups to E2F promoters. e.Promote initiation of transcription.
You have synthesized an enhancerless GFP reportergene in which the jellyfish GFP cDNA is placeddownstream of a basal promoter that functions inmice. You will now fuse this enhancerless reporter tothe three types of sequences listed below (x–z).a. Which of the three types of sequences would youuse for which of the three listed purposes (i–iii)? Ineach case, explain how the particular fusion wouldaddress the particular use.Types of sequences fused to the reporter:x. random mouse genome sequencesy. known mouse kidney-specific enhancerz. fragments of genomic DNA surroundingthe transcribed part of a mouse geneUses:i. to identify a gene’s enhancer(s)ii. to express GFP tissue-specificallyiii. to identify genes expressed in neuronsb. Which of the sequences (x–z) would you fuse to aparticular mouse gene of interest in order to express the protein product of the gene ectopically,that is, in a tissue in which the gene is not usuallyexpressed? Why might you want to do this experiment in the first…
A. Identify the mutation(s) that lead to the most loss in transcriptional activity, and discusswhether those match expectations based on the consensus sequence for the Initiator.B. Hypothesize a molecular mechanism to explain how the mutations identified in Part Aresult in loss of transcription activity.C. Identify whether any mutations cause transcription to initiate from a different positionthan wild-type, and provide a brief explanation as to why that occurs for those mutantcore promoters. THIS IS A PRIMER EXTENSION ASSAY
5a The two factors that bind directly to the DNA at Pacific sequences are TFIID and TFIIB- in general terms what is the function of each of these two transcription factors in the initiation of transcription This is not a graded question and it will never be graded, This is for studying purpose only
You have isolated two different mutants (reg1 andreg2) causing constitutive expression of the emu operon (emu1 emu2). One mutant contains a defect in aDNA-binding site, and the other has a loss-of-functiondefect in the gene encoding a protein that binds tothe site.a. Is the DNA-binding protein a positive or negativeregulator of gene expression?b. To determine which mutant has a defect in the siteand which one has a mutation in the binding protein, you decide to do an analysis using F′ plasmids. Assuming you can assay levels of the Emu1and Emu2 proteins, what results do you predict forthe two strains (i and ii; see descriptions below) ifreg2 encodes the regulatory protein and reg1 is theregulatory site?i. F′ (reg1−reg2+emu1−emu2+)/reg1+reg2+emu1+emu2−ii. F′ (reg1+reg2−emu1−emu2+)/reg1+reg2+emu1+emu2−c. What results do you predict for the two strains(i and ii) if reg1 encodes the regulatory proteinand reg2 is the regulatory site?
You have isolated a protein that binds to DNA in theregion upstream of the promoter sequence of the sysgene. If this protein is a positive regulator, which ofthe following would be true?a. Loss-of-function mutations in the gene encodingthe DNA-binding protein would cause constitutiveexpression of sys.b. Loss-of-function mutations in the gene encodingthe DNA-binding protein would result in little orno expression of sys.