Q: 2) Myoclonal epilepsy and ragged red fiber disease (MERRF) is a human condition named for the ragged…
A: Mitochondrial tRNA in humans has gained interest due to the discovery of associations between point…
Q: give the structure of post Squence 5'-AGCTA-3! Complete and give the Sturaute Structure. at…
A: DNA and RNA stand for deoxyribonucleic acid and ribonucleic acid respectively. DNA is…
Q: What is thee tRNA anticodon for the first 5’-ACGAUC-3’?
A:
Q: Red blood cells are normally circular in shape. Sickle cell anemia is a disorder that affects the…
A: sickle cell anemia is a genetic disorder caused by alternation in genetic sequence .
Q: et’s return to your patient with sickle cell anemia. Below is the RNA sequence from your patient…
A: Sickle cell disease causes often term that they are usually state as chronic hemolytic anaemia,…
Q: 6. Celiac disease is a disorder of the small intestine characterized by autoimmune response to…
A: Gluten protein is commonly found in many cereals like Wheat, barley, rye etc and is difficult to…
Q: determine if the individual is homozygous for presence of the Alu insertion(++), heterozygous (+-),…
A: Each Alu sub family member assertion locus was assayed by PCR analysis. It is done by using…
Q: 4. You are to choose the members of an expedition that will climb several high mour Each applicant…
A: Hemoglobin abnormalities are referred to as the type of blood disorders that have a major impact on…
Q: Alpha polypeptide (ADH1A). Give a detailed description of its role in the disease. Describe the…
A: Alpha polypeptide (ADH1A)- Alcohol dehydrogenase 1A is a type of enzyme which in humans it is…
Q: 2) Myoclonal epilepsy and ragged red fiber disease (MERRF) is a human condition named for the ragged…
A: Myoclonic epilepsy:It is related to a family of epilepsies which are present along with myoclonus.…
Q: Sodium nitrite, a common food preservative (page 906), is capable of causing mutations in an acidic…
A: Sodium nitrite, a common food preservative , is capable of causing mutations in an acidic…
Q: 6. Celiac disease is a disorder of the small intestine characterized by autoimmune response to…
A: Gluten protein is commonly found in many cereals like Wheat, barley, rye etc and is difficult to…
Q: Sickle-Cell Anemia is one disease that arises from a known point mutation in a protein. This…
A: Sickle cell anemia is a genetic disease. This disease is especially common for Africans.
Q: ckle cell anemia is a hereditary disease in which a faulty hemoglobin (Hb S) molecule is produced. A…
A: Hemoglobin is an iron-containing protein present in the red blood cells (RBCs). It transports oxygen…
Q: 21. The grouping together of several globular proteins in the structure of hemoglobin is referred to…
A: Proteins are the ultimate products of the genes. DNA is transcribed into m RNA and this is…
Q: The physical basis of sickle cell disease results from a hemoglobin mutant is prone to…
A: Sickle cell anemia: It is an inheritance disease and affects mainly Hemoglobin which delivers…
Q: 19) Thalassaemia is a genetic disorder in which the red blood cells in the body cannot carry oxygen.…
A: Given: Thalassaemia is a genetic disorder in which the red blood cells in the body cannot carry…
Q: Certain individuals with mild forms ofβ-thalassemia produce, in addition to normal adulthemoglobin…
A: Haemoglobin lepore is defined as a small group consisting of structurally abnormal haemoglobins…
Q: When doing automated sequencing, all 4 dideoxynucleotides are added to the same sequencing reaction,…
A: DNA sequencing is a biochemical method for determining the order of the nucleotide bases, adenine,…
Q: Staphylococcus nuclease is an enzyme that catalyzes the hydrolysis of DNA.The reaction is catalyzed…
A: Staphylococcal or micrococcal nuclease is a Ca2+-dependent extracellular enzyme that is produced by…
Q: 33. Band 3 protein exists as a 95-kDa multipass membrane protein that functions as the primary anion…
A: Given, Band 3 protein ,a protein which is essential for RBC membrane support and also acts…
Q: 2. Oxidative deamination of adenine leads to an A•T → G•C transition mutation. How does adenine…
A: Given, Oxidative deamination resulting, A.T>G.C transition mutation. Deamination of adenine forms…
Q: anemia (nih.gov) 3. Describe the effect of the amino acid change on protein function: How does the…
A: Point 3 is your answer. In the image uploaded below.
Q: There are almost 500 naturally occurring variants of hemoglobin. Most are the result of a single…
A: Hemoglobin is the protein molecule in red blood cells that transport oxygen (O2) from the lungs to…
Q: 11D The T-state structure of hemoglobin is an example of a whereas its alpha helices are an example…
A: Introduction: Hemoglobin is a respiratory pigment found in red blood corpuscles. It is made up of…
Q: 22. Describe the Induced fit of Hemoglobin, Hb (enzyme-like protein) which has quarternary structure…
A: The induced fit model is a model for the interaction of enzymes with substrates. It states that only…
Q: Hemoglobin variant Yakima contains His rather than Asp at the 99th position of each B chain (or the…
A: More than 1000 naturally occurring human haemoglobin variants have been discovered, mostly through…
Q: Red Blood Cell: Figure 9. Changes to the beta-globin subunit of hemoglobin in sickle cell disease…
A: Protein structure has many levels such as primary, secondary, tertiary and quaternary. Hemoglobin is…
Q: Which of the given disorder can be seen in an individual when the mutation includes substitution of…
A: Purines and pyrimidines are nitrogenous bases present in nucleic acids. Substitution of purine by…
Q: Substituting antisense oligonucleotide non-bridging oxygen atoms with a sulpha atom: Select
A: Ans. 1. Option d is correct The antisense nucleotide non bridging oxygen atom replace by the sulphur…
Q: One of your patients, a six-year-old girl who suffers from Sickle cell anemia, an inherited blood…
A: When a DNA sequence changes, it can be referred to as mutation. Effect of mutagens, exposure to…
Q: 2 When an oxygen molecule binds to the deoxyhemoglobin, multiple conformational changes happen that…
A: Hemoglobin is a protein that carries oxygen from lungs to tissues, and CO2 from tissues to lungs.…
Q: 36. Non-sense mutation results to the formation of a shorter protein than what should be…
A: In a nonsense mutation, or stop mutation, there is a change in DNA sequence that causes a…
Q: why TA of alcohol precipitation is used as TA of purified protein.
A: Alcohol precipitation is a widely used technique to concentrate nucleic acid (DNA/RNA). This is…
Q: Certain individuals with mild forms ofβ-thalassemia produce, in addition to normal adulthemoglobin…
A: Homologs have the same genes in the same loci where they provide points along each chromosome which…
Q: GCCCG-3' uence of amin ranscribed and ng strand) base pond with an a correspondir.
A: Coding strand : During transcription , the coding strand of DNA serves as a template for synthesis…
Q: Shortly discuss the above antibodie structure? Please discuss at your own words . Discussion should…
A: The picture given is the basic structure of an antibody(immunoglobulin) which is a Y-shaped…
Q: the relationship between mutation of RECQ5 and human disease, in particular exploring the effects on…
A: RECQ5:- it is a type of helicases. It is an ATP dependent helicase that can binds with single…
Q: Early detection and adherence to a strict dietary regimen have prevented much of the intellectual…
A: Phenylketonuria (PKU) is a rare inherited metabolic disorder in which the metabolism of…
Q: 2. Blood group type A antigen is a complex oligosaccharide which differs from H antigen present in…
A: Antigens are foreign molecules that bind to antibodies present in the serum of the host. Different…
Q: Suggest probable consequences of the following real or possible hemoglobinmutations. [Note: as…
A: Hemoglobin mutations: These variants alter hemoglobin structure and biochemical properties with…
Q: 2. Sickle-cell anemia is a genetic disorder caused by the abnormal gene for hemoglobin S. A single…
A: Sickle cell anemia It is an autosomal recessive disease. This is caused by a mutation caused at the…
Q: The function of the histidine residue at the C-terminal end of the beta subunits of hemoglobin…
A: Hemoglobin functions as the oxygen carrier in vertebrates. It is a tetrameric protein, each subunit…
Q: A peptide with the primary structure Lys–Arg–Pro– Leu–Ile–Asp–Gly–Ala is sequenced by the Edman…
A: Given Values: Efficiency of the edman cycle = 96% or 0.96 The second time it needs to be assumed =…
Q: The Number of Tryptophan Residues in Bovine Serum Albumin A quantitative aminoa acid analysis…
A: Molecular wt. of tryptophan = 204 Wt. of tryptophan in BSA = 0.58 % or 0.58 gm. Wt. of BSA = 100 gm.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- Shown below are two homologous lengths of the alpha and betachains of human hemoglobin. Consult a genetic code dictionary and determine how many amino acid substitutionsmay have occurred as a result of a single nucleotidesubstitution. For any that cannot occur as a result of a singlechange, determine the minimal mutational distance. Alpha: ala val ala his val asp asp met proBeta: gly leu ala his leu asp asn leu lysWhich of the given disorder can be seen in an individual when the mutation includes substitution of a purine by pyrimidine? 1. Chronic myelogenous leukemia 2. Sickle cell anaemia 3. a thalassemia 4. B thalassemiaBelow is the DNA base sequence for the normal protein for normal hemoglobin and the base sequence for (abnormal) sickle cell hemoglobin: Normal GGG CTT CTT TTT Sickle GGG CAT CTT TTT A)Transcribe and translate the normal and sickle cell DNA. B)Identify this as a point or frameshift mutation. Explain.
- Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute myeloid leukaemia Select one: A.t(8;21) translocation (RUNX1‐RUNXT1 fusion) B.DNMT3A mutation C.TP53 deletion D.NPM1 (nucleophosmin) mutationTwo possible point mutations are the substitution of lysine for leucine or the substitution of serine for threonine. Which is likely to be more serious and why?Alpha polypeptide (ADH1A). Give a detailed description of its role in the disease. Describe the impact of the disease on society.Describe a way in which your gene can be manipulated to treat the disease. Assume you can make any changes to the protein product and describe specifically how it will affect its interaction with other molecules.
- Of all the genes in the human genome, the ones withthe most characterized Alu insertions are those thatcause hemophilia, including several insertions in thefactor VIII and factor IX genes. Based on this fact, yourcolleague hypothesizes that the Alu element prefers toinsert into these genes. Do you agree? What other reason can you provide that also explains these data?What is thee tRNA anticodon for the first 5’-ACGAUC-3’?The protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb. How is thisdifference possible?
- Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′Diamond–Blackfan anemia (DBA) is a rare, dominantgenetic disorder characterized by bone marrow malfunction,birth defects, and a predisposition to certaincancers. Infants with DBA usually develop anemia in the firstyear of life, have lower than normal production of red blood cellsin their bone marrow, and have a high risk of developing leukemiaand bone cancer. At the molecular level, DBA is causedby mutations in any one of 10 genes that encode ribosomalproteins. The first-line therapy for DBA is steroid treatment,but more than half of affected children develop resistance tothe drugs and in these cases, treatment is halted. DBA can betreated successfully with bone marrow or stem cell transplantsfrom donors with closely matching immune system markers.Transplants from unrelated donors have significant levels ofcomplications and mortality. While a stem cell transplant from an unaffected donor is currentlythe only cure for DBA, genome-editing technologies mayone day enable the correction of…Diamond–Blackfan anemia (DBA) is a rare, dominantgenetic disorder characterized by bone marrow malfunction,birth defects, and a predisposition to certaincancers. Infants with DBA usually develop anemia in the firstyear of life, have lower than normal production of red blood cellsin their bone marrow, and have a high risk of developing leukemiaand bone cancer. At the molecular level, DBA is causedby mutations in any one of 10 genes that encode ribosomalproteins. The first-line therapy for DBA is steroid treatment,but more than half of affected children develop resistance tothe drugs and in these cases, treatment is halted. DBA can betreated successfully with bone marrow or stem cell transplantsfrom donors with closely matching immune system markers.Transplants from unrelated donors have significant levels ofcomplications and mortality. Given that a faulty ribosomal protein is the culprit and causesDBA, discuss the possible role of normal ribosomal proteins.Why might bone marrow cells be…