You figure out a way to replicate DNA in a test tube by adding double-stranded DNA template, dNTPs, NTPs and all the proteins needed for replication. However, you forget to add DNA ligase. In a well-labelled diagram, fill in the following parts of the growing replication fork shown.1) Fill in any replicated nucleic acids, using at least 2 Okazaki fragments where appropriate, Label the new strands as “leading” or “lagging”, Label the 5’ and 3’ ends of all nucleic acid strands that you draw, Draw a circle representing the location of DNA helicase (do not include any other proteins in your drawing)

DNA (Deoxyribonucleic acid) replication refers to the process that forms two identical DNA strands…

1) Fill in any replicated nucleic acids, using at least 2 Okazaki fragments where appropriate, Label the new strands as “leading” or “lagging”, Label the 5’ and 3’ ends of all nucleic acid strands that you draw, Draw a circle representing the location of DNA helicase (do not include any other proteins in your drawing)

1) Fill in any replicated nucleic acids, using at least 2 Okazaki fragments where appropriate, Label the new strands as “leading” or “lagging”, Label the 5’ and 3’ ends of all nucleic acid strands that you draw, Draw a circle representing the location of DNA helicase (do not include any other proteins in your drawing)

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 2VCQ: Figure 14.14 You isolate a cell strain in which the joining of Okazaki fragments is impaired and...

See similar textbooks

Similar questions

When DNA replication was investigated by using heavy, N15 DNA to mark the original molecules, and light, N14 DNA to mark the newly synthesized molecules, one band was found in the middle of the centrifuge column after one round of replication, and two bands were found (middle and top of column) after 2 rounds of replication. Imagine that after 1 round of replication 2 bands were found, one at the bottom and one at the top of the centrifuge column. In that case, what model of DNA replication would have been supported? The dispersive model The conservative model The Franklin model The semi-conservative model
For the template DNA below, which includes one labeled end of the template DNA, clearly label the following: The origin of replication The most recently added base on each strand you draw for b & c, marked with an asterisk (star). Where DNA helicase would be & direction it moves. Where DNA ligase will be needed after replication is complete.
A scientist successfully analyzed a new micro-organism. Because this micro-organism contains double-stranded DNA as genetic material, Meselson-Stahl techniques was employed. The following shows the results of the experiment where L – light chain (14N) and H – heavy chain (15N).What is the mechanism of replication in this organism in the picture? Explain how you got the answer. The following piece of DNA is sequenced using the dideoxy method: 3’-AAGCGGCTAATCC-5’. Accidentally, you forget to include dATP in the four reactions that contain a ddNTP. What is the sequence of the daughter strand produced from this sequencing activity? Show the process. The following piece of DNA is sequenced using the dideoxy method: 3’-AAGCGGCTAATCC-5’. Accidentally, you forget to include dATP in the four reactions that contain a ddNTP. How many bands will appear in the lane containing ddATP? Show the process. The following piece of DNA is sequenced using the dideoxy method: 3’-AAGCGGCTAATCC-5’.…
Using 14N isotope medium for DNA replication instead of 15N, what would be observed ifDNA replication were conservative in one cycle of replication/in three cycles? How aboutdispersive replication in one cycle, in three cycles?
On paper, replicate the following segment of DNA: 5’ A T C G G C T A C G T T C A C 3’ 3’ T A G C C G A T G C A A G T G 5’a. Show the direction of replication of the new strands and explainwhat causes lagging and leading strands to show different patternsof replication.b. Explain how this is semiconservative replication. Are the newstrands identical to the original segment of DNA?
Why does DNA have a leading strand and a lagging strand during replication?Select the correct row below that fills in the following blanks to answer the question above.___1st___ has to attach the new free-floating nucleotides to the ___2nd___ of the newly formed strand. The two strands of a DNA molecule are antiparallel, so in order for the lagging strand to be formed in the same direction, it has to be done in Okazaki fragments going in a ___3rd___ direction. Select one: a. 1st 2nd 3rd DNA polymerase 3' end 5' to 3' b. 1st 2nd 3rd DNA polymerase 5' end 3' to 5' c. 1st 2nd 3rd DNA ligase 3' end 5' to 3' d. 1st 2nd 3rd DNA helicase 5' end 3' to 5'
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side
You decide to repeat the Meselson-Stahl experiment, except this time you plan to grow the E. coli cells on light 14N medium for many generations and then transfer them to heavy 15N medium and allow them to grow for 2 additional generations (2 rounds of DNA replication). If the conservative model of DNA replication was correct, what is the expected distribution of DNA in the density gradient after two rounds of replication? Multiple Choice One band of intermediate density. One band of light density. One band of heavy density. One band of light density and one band of heavy density. One band of light density and one band of intermediate density.
In bacterial cells, nucleotide excision repair involves which of the following proteins? DNA glycosylase AP endonuclease photolyase AlkB UvrABC proteins If Meselson and Stahl had results from density gradient analysis of bacterial DNA that indicated only two bands, one of the original density and one that was the same as unlabeled DNA, and no intermediate density band, this would indicate that DNA replication is: constructive semiconservative conservative consecutive cannot determine from the information given 6.In E. coli, which DNA polymerase is primarily responsible for filling in the gaps in the DNA generated during nucleotide excision repair? DNA polymerase I DNA polymerase II DNA polymerase IV DNA polymerase V none of the above
The speed of DNA replication at a replication fork is about 100 nucleotides per second in human cells. What is the minimum number of origins of replication that a human cell must have if it is to replicate its DNA once every 24 hours?
What are the three models of DNA replication? With the aid of illustrations, show how the Meselson Stahl experiment come to the conclusion of one model of DNA replication. Is DNA replication bidirectional? How did you arrive at this conclusion? Explain the bacterial replication model that supports this conclusion.
Which statement below best describes what these data might have demonstrated to Kornberg about the process of replication? CHOOSE ONE and explain the rationale behind your answer in a minimum of four sentences. A. Products of replication are DNA polymers. B. DNA Pol I-mediated replication is a high-fidelity (i.e., no mistakes) process C. DNA Pol III-mediated replication gives rise to two daughter strands, one which is made of only the original templates, and one of which is only newly synthesized polymer. D. In DNA, all 4 classes of nitrogenous bases are more or less equally represented E. A pairs with T and C pairs with G