Step 2- Draw (DO NOT COPY-PASTE Images from the Internet) a picture of what is happening in each step in the box labeled "illustration." Label the following structures in each drawing where appropriate: DNA, MRNA, nucleus.cytoplasm, ribosome, rRNA, tRNA, amino acid, polypeptide chain Step 3- Describe (IN YOUR OWN WORDS) what is happening in each step in the box labeled "description." Be sure to include which process (transcription or translation) is being shown and where the process takes place (nucleus or ribosome). Transcription - Initiation Illustration Description A initiation is the beginning of transcription

Step 2- Draw (DO NOT COPY-PASTE Images from the Internet) a picture of what is happening in each step in the box labeled "illustration." Label the following structures in each drawing where appropriate: DNA, MRNA, nucleus.cytoplasm, ribosome, rRNA, tRNA, amino acid, polypeptide chain Step 3- Describe (IN YOUR OWN WORDS) what is happening in each step in the box labeled "description." Be sure to include which process (transcription or translation) is being shown and where the process takes place (nucleus or ribosome). Transcription - Initiation Illustration Description A initiation is the beginning of transcription

Name: Step 2- Draw (DO NOT COPY-PASTE Images from the Internet) a picture o
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Step 2- Draw (DO NOT COPY-PASTE Images from the Internet) a picture of what is happening ineach step in the box labeled "illustration." Label the following structures in each drawing whereappropriate: DNA, MRNA, nucleus,cytoplasm, ribosome, rRNA, tR

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 1TYK: Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a...

See similar textbooks

Similar questions

Match Column A with Column B. transports amino acids to the site of protein synthesis has anticodon loop directs amino acid sequence of proteins contains the Shine-Delgarno sequence synthesized in the eukaryote nucleus found inside the ribosome region where the RNA binds to the DNA template…
Figure 14.10 In eukaryotic cells, DNA and RNA synthesis occur in a separate compartment from protein synthesis. In prokaryotic cells, both processes occur together. What advantages might there be to separating the processes? What advantages might there be to having them occur together?
Eukaryotic and prokaryotic ribosomes are similar in that: a. both contain a small subunit, but only eukaryotes contain a large subunit. b. both contain the same number of proteins. c. both use mRNA to assemble amino acids into proteins. d. both contain the same number of types of rRNA. e. both produce proteins that can pass through pores into the nucleus.
Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
21.An RNA or DNA molecule is a polymer made of subunits called 22.Which of the following is NOT needed for protein synthesis a, tRNA b, spindle fibers c, enzymes d, ribosomes 23. What does DNA do inside the cell? it destroys incorrect nucleotides in the nucleus it maintains the integrity of the nuclear membrane It prevents the excess buildup of nucleotide bases it directs the synthesis of proteins 24. What is a genome? Group of answer choices The complete collection of an organisms genetic information The combination of proteins and DNA found in the sex cells All the genes found in a population The number of chromosomes found in each cell
Which of the following processes takes place in the nucleoli within the eukaryotic nucleus?a) ribosome assemblyb) rRNA gene transcriptionc) telomerase assemblyd) tRNA processinge) all of the above Please explain choices
It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand: GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT It is now time to make a protein. Using the same stand of DNA, transcribe it to mRNA, then translate to an amino acid sequence (use the codon table below).
A scientist observing a cell during gene expression would be able to easily distinguish it as a prokaryotic cell by which of the following observations? Group of answer choices as soon as the DNA introns are removed from the template after the 5' caps are converted to mRNA after a transcription initiation complex has been formed during transcription once the pre-mRNA has been converted to mRNA 2.Scientist wanted to determine what molecule held the ‘gene ‘ if they did a study in which a cell was infected by a virus,which part of the virus actually caused the infection inside the cell!? -Dna -ribosome -protien -Rna
Explain, in detail, the process of DNA replication. Include in your answer, a diagram, the cellular location and reason for DNA replication, the names of all enzymes/molecules involved, and the sequence of events. a. Explain, in detail, the process of mRNA translation. Include in your answer, a diagram, the cellular location and reason for translation, the names of all enzymes/molecules/sites involved, and the sequence of events. Please help explain in fewer than 8 sentences!
Scientists wanted to determine what molecule held the 'gene'. If they did a study in which a cell was infected by a virus, which part of the virus actually caused the infection inside the cell? Group of answer choices DNA ribosome protein RNA 2. A scientist observing a cell during gene expression would be able to easily distinguish it as a prokaryotic cell by which of the following observations? Group of answer choices as soon as the DNA introns are removed from the template after the 5' caps are converted to mRNA after a transcription initiation complex has been formed during transcription once the pre-mRNA has been converted to mRNA
Item33 Item 33 The function of the nucleolus is to make Multiple Choice DNA molecules. the subunits of ribosomes. the secretions that will be packaged by the Golgi apparatus. histones. the deoxyribose sugar. Item34 Item 34 The building blocks that form the DNA double helix are called Multiple Choice nucleoli. nucleotides. steroid bases. nitrogenous acids. nuclear pores. Item35 Item 35 Which of the following is considered a required enzyme for the process of transcription? Multiple Choice Aminoacyl-tRNA synthetase DNA polymerase RNA polymerase Amine transferase
Which of the following statements most accurately describes the action of the enzyme RNA polymerase?Select one 1.) RNA polymerase will transcribe only the exons by skipping over the introns within a eukaryotic gene sequence 2.) RNA polymerase will transcribe both DNA strands, moving in the 3' to 5' direction for one strand and 5' to 3' on the other 3.) RNA polymerase will transcribe both DNA strands, but only one RNA molecule will be used during translation 4.)None of the statements accurately describe the function of RNA polymerase