Tay-Sachs disease (TSD) is a fatal genetic disorder, that results in progressive destruction of the nervous system. Tay-Sachs is caused by a mutation in the gene that codes for an enzyme called hexosaminidase-A (Hex-A). Hex A CDNA from normal and a Tay-Sachs individual was sequenced using the same primer. This is the coding strand and starts in-frame at amino acid position #78. Results are shown below. Read the darkest band in each row. Normal Tay-Sachs (-) ATG C ATG C (+) a. Write each coding strand DNA sequence, normal and Tay-Sachs 5' to 3' b. Write the amino acid sequence that will be translated from each sequence, normal and Tay-Sachs C. Describe the type of mutation? Predict the effect of this mutation on the He> A protein.

Tay-Sachs disease (TSD) is a fatal genetic disorder, that results in progressive destruction of the nervous system. Tay-Sachs is caused by a mutation in the gene that codes for an enzyme called hexosaminidase-A (Hex-A). Hex A CDNA from normal and a Tay-Sachs individual was sequenced using the same primer. This is the coding strand and starts in-frame at amino acid position #78. Results are shown below. Read the darkest band in each row. Normal Tay-Sachs (-) ATG C ATG C (+) a. Write each coding strand DNA sequence, normal and Tay-Sachs 5' to 3' b. Write the amino acid sequence that will be translated from each sequence, normal and Tay-Sachs C. Describe the type of mutation? Predict the effect of this mutation on the He> A protein.

Name: Tay-Sachs disease (TSD) is a fatal genetic disorder, that results in
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Tay-Sachs disease (TSD) is a fatal genetic disorder, that results in progressivedestruction of the nervous system.Tay-Sachs is caused by a mutation in the gene that codes for an enzyme calledhexosaminidase-A (Hex-A).Hex A CDNA from normal and a Tay-

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region. 4C. In NOT more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus?
In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3’-TACCACHTGGACTGAGGACTCCTCTTCAGA-5' What is the sequence for the partner strand?
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand?
Huntington’s disease is an inherited neurological ailment with a variable age of onset. A protein called huntingtin has a sequence of repeated glutamine residues, all encoded by CAG. The number of repeated CAG triplets is expanded in Huntington’s disease, apparently as the result of replication errors. The age of onset is related to the number of CAG triplets in the repeat region; the more glutamine codons, the earlier the onset. Describe experimental evidence, using Southern blotting, that is consistent with this finding.
. Which of the following enzymes can break, and rejoin, phosphodiester bonds during the normal DNA replication process in the chromosomes of E. coli cells? single-stranded binding proteins RNA polymerase topoisomerase DNA helicase DNA ligase The mutation causing sickle-cell anemia in humans, which changes the normal T to an A in the sixth codon (substituting valine for glutamic acid), occurs in which gene of the hemoglobin family? the a-globin gene (alpha) the b-globin gene (beta) the g-globin gene (gamma) the d-globin gene (delta) the e-globin gene (epsilon) The hypermutable condition, which allows cells to “play the lottery” by lowering the fidelity of DNA replication, was first discovered in which of the following prokaryotes? Saccharomyces cerevisiae Amoeba dubia Drosophila melanogaster Homo sapiens Escherichia coli
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
Below is a portion of an exon from a gene that encodes protein X in the genome of the plant Arabidopsis. Wildtype DNA3’ TTC AAT GCT CCG AAT ACC 5’ template strand5’ AAG TTA CGA GGC TTA TGG 3’ non-template strand A new strain (Strain B) of Arabidopsis is identified with the same region of the gene coding for protein X: 3’ TTC AAT GCT CCC AAT ACC 5’ template strand5’ AAG TTA CGA GGG TTA TGG 3’ non-template strand Compare the two DNA sequences and look for any differences. Based on what you find a. There is no mutation in Strain B compared to Strain A. b. After the point of the mutation, all the amino acids encoded by the Strain B template will be different than the Strain A protein X. c. Protein X made from the Strain B template will be much shorter than protein X made from the Strain A template d. Protein X from Strain B will have one amino acid difference that would not affect protein function. e. There is a mutation but there will not be any difference in the…
A small section of bacterial DNA template (antisense) strand has the following nucleotide sequence: CGA AAA GAG AAT A mutation in the above sequence involved a substitution of a single base, resulting in an incomplete protein due to a nonsense mutation. Which of the following gen sequences exemplifies the mutation described above? a. CGA UAA GAG AAT b. CGA AAA AAG AAT c. CGA AAA GAG ACT d. UGA AAA GAG AAT
Would a gain of function mutaion that occurs in the first exon of a gene with twelve exons more likely be missense or nonsense? Briefly explain your choice. List one disease that we studied in class that is due to a gain of function.
A small section of bacterial DNA template (anti-sense) strand has the following nucleotide sequence: AAG TAT TAT GCA A mutation in the above sequence involved the insertion of a single base, leading to a shift in the reading frame of the gene, resulting in altered amino acids downstream from the insertion. Which of the following gene sequences exemplifies the mutation described above? a. AAG CTA TTA TGC A b. AG TAT TAT GCA c. AAG TATU TAT GCA d. AAG TAT TAGT GCA