In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.

In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3’-TACCACHTGGACTGAGGACTCCTCTTCAGA-5' What is the sequence for the partner strand?
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand?
in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'TGCGTGTGTGC3' and its complement, how many copies of this sequence are present in the bandicoot genome?
The DNA of a deletion of alpha bacteriophage has a length of 15 micrometers instead of 17 micrometers? How many base pairs are missing from this mutant?
. While studying the structure of a small gene that was recently sequenced during the Human Genome Project, an investigator notices that one strand of the DNA molecule contains the following: 20 adenine (A) bases 30 cytosine (C) bases25 guanine (G) bases 22 thymine (T) bases How many of each base is found in the complete double-stranded molecule?
the one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?
What is an Okazaki fragment? In which strand of replicating DNA are Okazaki fragments found? Based on the properties of DNA polymerase, why is it necessary to make these fragments?
The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA?
What part(s) of a nucleotide (namely, phosphate, sugar, and/orbase) is(are) found in the major and minor grooves of doublestrandedDNA, and what part(s) is(are) found in the DNA backbone?If a DNA-binding protein does not recognize a specificnucleotide sequence, do you expect that it binds to the majorgroove, the minor groove, or the DNA backbone? Explain.
In the following sequence, a cytosine was deaminated and is now a uracil (underlined). 5’-GGTAUTAAGC-3’ a. Which repair pathway(s) could restore this uracil to cytosine? b. If the uracil is not removed before a DNA replication fork passes through, what will be the sequences of the two resulting double helices? Provide the sequences of both strands of both helices. Label the old and new strands and underline the mutation(s). c. Could the mismatch repair pathway fix the mutations you’ve indicated in part b? d. If the cell undergoes mitosis, and the replicated DNAs are distributed into the two daughter cells. Will 0, 1, or 2 daughter cells have a mutation in this sequence?