31If a point substitution mutation changes the sequence 5'ATGAAA3' to5'ACGAAA3' in the MIDDLE of the coding region, what is the most likelySecond letterresult?Phe UCUUUCJUAU TyrUUTUGU 1UGCUAA Stop UGA StopUAG Stop UGG TrpUCUACJCysSerUUAUCALeuUUGUCGCUCUCCUACUGCCUCAU)CGUHisCCCCAC)LeuCAProArgCAAGlnCAGCGACGGAUUAAUAAC Asn AGCThrAAAACUAGUAUC lle ACCSerAUAAUG Met ACGACAAGA 1AAG Lys AGG ArgGUUGUCValGCUGAU]AspGAC)AlaGGUGGCGCCGUAGCAGAA1GGAGlySelect an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer.ano protein is madeno effectprotein has altered amino acid sequenceprotein is not made because of frameshift mutationThird letterFirst letter

Name: 31If a point substitution mutation changes the sequence 5'ATGAAA3' to
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 31If a point substitution mutation changes the sequence 5'ATGAAA3' to5'ACGAAA3' in the MIDDLE of the coding region, what is the most likelySecond letterresult?Phe UCUUUCJUAU TyrUUTUGU 1UGCUAA Stop UGA StopUAG Stop UGG TrpUCUACJCysSerUUAUCALeuUUGUCGC

Point mutation is a genetic mutation in which a single nucleotide base is altered, inserted or…

Science

Biology

If a point substitution mutation changes the sequence 5'ATGAAA3' to 5'ACGAAA3' in the MIDDLE of the coding region, what is the most likely Second letter result? UCU UCC UCA UUG Leu UcG UUU Phe UAU UAC Tyr UGU Cys UGC UAA Stop UGA Stop UAG Stop UGG Trp G UC Ser UUA CUU CAU CAC CCU CGU CGC CGA CỤC Leu CCA CUA CCC Pro His CAA Arg CUG CAG Gin CCG CGG AUU ACU AAU) AAC Asn AGC Ser Thr AAA1 AAG Lys AGG Arg AGU AUC lle ACC AUA ACA AUG Met ACG AGA GCU GCC GCA GUU GAU) GAC Asp GGC Ala GGU GUC Val G GUA GAA1 GGA Gly Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. no protein is made no effect protein has altered amino acid sequence protein is not made because of frameshift mutation Third letter First letter

If a point substitution mutation changes the sequence 5'ATGAAA3' to 5'ACGAAA3' in the MIDDLE of the coding region, what is the most likely Second letter result? UCU UCC UCA UUG Leu UcG UUU Phe UAU UAC Tyr UGU Cys UGC UAA Stop UGA Stop UAG Stop UGG Trp G UC Ser UUA CUU CAU CAC CCU CGU CGC CGA CỤC Leu CCA CUA CCC Pro His CAA Arg CUG CAG Gin CCG CGG AUU ACU AAU) AAC Asn AGC Ser Thr AAA1 AAG Lys AGG Arg AGU AUC lle ACC AUA ACA AUG Met ACG AGA GCU GCC GCA GUU GAU) GAC Asp GGC Ala GGU GUC Val G GUA GAA1 GGA Gly Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. no protein is made no effect protein has altered amino acid sequence protein is not made because of frameshift mutation Third letter First letter

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
mRNA sequence of A gene If we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17CàU 36GàA 49GàU 115AàC 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
. A mutational lesion results in a sequence containing amismatched base pair:5′ AGCTGCCTT 3′3′ ACGATGGAA 5′CodonIf mismatch repair occurs in either direction, whichamino acids could be found at this site?
What 2 aspects can you observe in this animal DNA that indicates that it is the regulatory part of a eukaryotic transcription unit? (The spaces are added to make the sequence easier to read). AGAGGGCGGT CCGTATCGGC CAATCTGCTC ACAGGGCGGA TTCACACGTT GTTATATAAA TGACTGGGCG TACCCCAGGG TTCGAGTATT CTATCGTATG GTGCACCTGA CT..................
5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’s
mRNA sequence of A gene Write the amino acid sequence of the gene A. 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’
Below is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?
8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAACGTTAC 8b. Where did the mutation take place?
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
1. Here is the amino acid sequence of part of a hypotheticalgene you want to clone:Pro-Arg-Tyr-Met-Cys-Trp-Ile-Leu-Met-Ser a. What sequence of five amino acids would give a 14-merprobe with the least degeneracy for probing a library tofind your gene of interest? Notice that you do not use thelast base in the fifth codon because of its degeneracy. b. How many different 14-mers would you have to makein order to be sure that your probe matches thecorresponding sequence in your cloned gene perfectly? c. If you started your probe one amino acid to the left of theone you chose in (a), how many different 14-mers would youhave to make? Use the genetic code to determine degeneracy.