Thee Structure DNA1. Complete the following tasks using the DNAillustration.• Color all of the phosphate groups pink.Color the deoxyribose sugars purple.Draw a square around a nucleotide.Draw a circle around a base pair.Color each adenine green and label it with an A.• Color each thymine orange and label it with a T.Color each cytosine blue and label it with a C.Color each guanine yellow and label it witha G.2. Circle the full name of DNA.Deoxyribonucleic acidRibonucleic acidMononucleic acid3. Draw a line through the part below that isNOT one of the 3 parts of a nucleotide.DeoxyriboseRibosePhosphate groupNitrogenous base4. Circle one word from each column that bestdescribes the shape of DNA.First WordSingleDoubleSecond WordHelix :Line5. Circle the part(s) of the nucleotide that makeup the sides of a DNA molecule.SugarPhosphate group Nitrogen base6. Circle the part(s) of the nucleotide that makeup the center of a DNA molecule.Sugar Phosphate group Nitrogen base7. Complete the base pairing rules.A pairs withpairs withO Science from the South 2020

Answer 2 is Full form of DNA is deoxyribonucleic acid. DNA consists of polynucleotide strand.…

Answered: Te Structure 2 DNA

Science

Biology

Te Structure 2 DNA

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 15QP: Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw...

See similar textbooks

Similar questions

Can somone check my answers are in bold please for both questions :Which is NOT true of the different conformations of DNA? A. Z-DNA is a left-handed spiral. B. Both A-DNA and B-DNA are dehydrated. C. A-DNA and B-DNA are right-handed spirals. D. A-DNA and Z-DNA segments are limited to short regions of DNA. For double-stranded DNA, consider the following base ratios: A/G C/T C/G (A+C)/(G+T) (A+G)/(C+T) (A+T)/(G+C) Which of those ratios always equals 1? A. 3, 4, and 5 B. 3 and 6 C. 1, 4, and 5 D. 4 and 6 E. 1 and 2
Please help C. Even in automated sequencing, where you can include all 4 ddNTPs in one reaction, you need to include "normal" dNTPs as well as the ddNTPs - why are these necessary? Why can't you just put in the ddNTPs, since you've got all four of them available to the DNA polymerase?
a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
Show all work. 1. A) Produce a double-stranded piece of DNA that is 11 base pairs long using the letters A, C, G, T and label the ends of both strands using 3' and 5' appropriately. B) Calculate the ratio of (A+T)/(G+C) and (A+G)/(C+T). Explain why one ratio will always be equal to 1.0?
May you please help me with this? A sample of purified DNA was incubated with deoxyribonuclease (DNAse) at 37oC. An aliquot was removed from the reaction mixture every minute for 5 minutes and the A260 recorded. The following data were obtained. Time (min) A260 0 0.60 1 0.64 2 0.67 3 0.70 4 0.72 5 0.73 Describe the action of deoxyribonuclease on DNA and explain the increase in A260.
Please explain it simply, and don't over-explain. Thanks! A. How is DNA structure arranged to allow it to do its function?
Need help 1) Say you have an organism with a genome of 1 thousand bases (103) and a forward primer made up of 5 nucleotides (aka, a 5-mer) a)How many possible 5-mers are there? Remember that each position in the 5-mer has one of four nucleotides. b) Pick a 5-nucleotide position at random in the genome: what’s the probability that your forward primer matches there? Focus for now just on one strand of DNA. c) Pick a random 5-nucleotide position in the genome: what’s the probability that your forward primer does NOT match there? Focus for now just on one strand of DNA. d) How many physical locations might your forward primer sit in the genome? Focus just on one strand of DNA. Ignore whether or not it matches at a given location. this is one question with different parts. I would really appreciate it if all parts are answered. and I will defiantly rate.
Please ASAP. Thank you. Regarding the double helix of DNA, which of the following is true? a. Guanine pairs up with cytosine with three hydrogen bonds b. Complementary strands of DNA are held together by covalent bonds c. The backbone consists of ribose sugars H-bonded to phosphate groups d. Uracil pairs up with adenine with two hydrogen bonds
Can u provide a replication fork structure using deoxyribose, phosphate, guanine, adenine, cytosine, and thymine
BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would be created by cutting the normal gene with BamHI?
1d) Whether done manually or automated, DNA sequencing gels are always made of polyacrylamide rather than agarose. Why can't agarose be used for a sequencing gel, as it is for other DNA gel electrophoresis?
Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.