Even in automated sequencing, where you can include all 4 ddNTPs in one reaction, you need to include "normal" dNTPs as well as the ddNTPs - why are these necessary? Why can't you just put in the ddNTPs, since you've got all four of them available to the DNA polymerase?

Even in automated sequencing, where you can include all 4 ddNTPs in one reaction, you need to include "normal" dNTPs as well as the ddNTPs - why are these necessary? Why can't you just put in the ddNTPs, since you've got all four of them available to the DNA polymerase?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 12TYK

See similar textbooks

Related questions

Q: The condensation reaction catalyzed by ß-ketoacyl-ACP synthase synthesizes a four-carbon unit by…

A: Malonyl CoA is formed from carboxylation of Acetyl CoA through an ATP consuming process by biotin…

Q: In the article the authors reference the canonical forces in protein folding. Describe how these…

A: As per the central dogma of molecular biology, the DNA contain the information needed to synthesize…

Q: How is aquaporin synthesised? List step by step. How is this protein made and targeted to its final…

A: Aquaporins (AQP) are protein channels that function in the transfer of water at very high rates…

Q: 1. How does the resin facilitate purification in glutathione S-tranferase (GST) affinity? 2.…

A: In Biochemistry, affinity chromatography is a technique used for the purification of protein based…

Q: The figure below shows a polynucleotide: a) Label the 5' and the 3'…

A: Polynucleotide are polymer of nucleotides which are formed by the condensation of nucleotide. The…

Q: Will weighs 80 kg and his plasma osmolarity is 280 mOsm/L. He eats a salty snack containing 250 mM…

A: Plasma Osmolarity: The number of solute particles per 1 L of solvent is referred to as osmolarity.…

Q: What is the principle involved in mucic acid test?

A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified into monosaccharides,…

Q: Under aerobic conditions of high ratios of NADH/NAD+ and ATP/ADP, as pyruvate is utilized for its…

A: Pyruvate under Aerobic conditions: Pyruvate can diffuse into mitochondria under aerobic conditions,…

Q: Describe the biological functions of lipids. What factorscan affect the transition temperature (Tm)…

A: Lipid is a biomolecule which is soluble only in nonpolar solvents. They are hydrocarbons which…

Q: In an Absorptive (fed) state Which predominates? Anabolic or catabolic processes? Which ones…

A: Metabolic pathways are a series of process which includes chemical reactions occurring in a cell.…

Q: Which of the following statements about chaperones is FALSE? a. Chaperones prevent incorrect…

A: Proteins mostly get folded into their native states spontaneously. Some proteins require assistance…

Q: Please help with 2a) 2a) There are two different DNA polymerase enzymes, DNA Polymerase I and DNA…

A: Replication is the process of duplication of two strands of a double stranded DNA. In bacteria, the…

Q: Describe the signal transduction pathway for Two or Three of the following: a) ß-adrenergic…

A: Beta adrenergic receptor is a G-protein-coupled receptor communicating through the Gs alpha…

Q: Whether done manually or automated, DNA sequencing gels are always made of polyacrylamide rather…

A: Sequencing DNA entails finding the order of the four chemical building components known as "bases"…

Q: The side chain of which residue can be hydrogen bond donor: a. Thr b. Ala c. Ile d. Pro e.…

A: There are twenty standard amino acids that makeup all the proteins present in our body. These twenty…

Q: The following are true of the mitochondrial structure I. The inner mitochondrial membrane is…

A: Mitochondria are power house of cell, known to synthesize ATP. They are membrane bound organelles…

Q: A D. J B с

A: Reactions can proceed forward or reverse reactions can proceed spontaneously without the help of…

Q: In the alpha-helices, which of the following statement is NOT true? a. Backbone carbonyl…

A: Proteins are composed of amino acids that are attached together via peptide bonds. The linear chain…

Q: 1. State if true or false a. GLUT5 transporter carries fructose from the intestinal lumen into the…

A: GLUT5 Transporter : GLUT5 is a fructose transporter found & expressed on the apical border of…

Q: How does mottling on tablets appear during drying process? Give your insights on how mottling can be…

A: Introduction During tablet processing different types of defect may arise. An tablet should be free…

Q: The smooth endoplasmic reticulum can be described in what ways? Select the correct response(s): It…

A: The endoplasmic reticulum is composed of a network of flattened sacs and branching tubules that…

Q: 6.) Calculate the concentration (N) of arsenic acid (H3A504) in a solution if 25mL of that solution…

A: Given that, Volume of 0.1894 molar KOH required to neutralize anseric acid is 35.21 mL. Volume of…

Q: Based on the structure of sucrose below, is it classified as a reducing sugar? 6CH OH ОН ОН 3…

A: Chemically, carbohydrates are polyhydroxy aldehydes/ketones. They have the general formula :…

Q: The figure below illustrates what reactions of amino acids? coo &C=0 CH₂ CH₂ 0=( 00 + NHⓇ NAD(P)H+H…

A: The amino group, carboxyl groups, and side chains of amino acids all play a role in how amino acids…

Q: Which of the following statements about protein folding is incorrect? Select all. GroEL/GroES allow…

A: The proteins fold into their proper three dimensional structure in order to be biologically active.…

Q: The following proteins were separated by SDS-PAGE in the presence of mercaptoethanol. Sketch the…

A: SDS-PAGE is an electrophoretic technique that separates proteins based on their size. This method…

Q: What is the charge on the following peptide at standard biochemical pH? S-Y-D-F-K-I-V-F-L-L +2 -1 O…

A: Peptides are composed of amino acids. Amino acids are biomolecules with an alpha carbon bonded to an…

Q: Which of the following is correctly classified? O Arachidic (20:0) is a medium chain unsaturated…

A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…

Q: 4. RNAse A cleaves the phosphodiester backbone of RNA. Draw its mechanism.

A: INTRODUCTION : RNA - It is called Ribonucleic acid, It is a nucleic acid which is present in all…

Q: 12. The graph shows values of arterial plasma bicarbonate concentration and pH for different persons…

A: Metabolic alkalosis is caused by acid base imbalance in the blood. It is characterised by increase…

Q: Question 21 of 25 What are Gram-negative bacteria? Select the correct response(s): They have a cell…

Q: His-Met-Asp-Tyr-Phe-Ser Calculate an approximate pI (isoelectric point) for this peptide. Please use…

A: Recall that: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…

Q: Lactate dehydrogenase isoforms contain "H" and "M" subunits. In total, how many subunits are found…

A: - A dehydrogenase is an enzyme that transfers a hydride from one molecule to another. - Enzyme…

Q: L 3

A: Since you have asked multiple questions, we will ask only first question for you. In order to get…

Q: Now use the equations above and the empirical values below to calculate VO₂ (the rate of oxygen…

Q: QUESTION: For each enzyme identify the transition-state inhibitor analog by drawing a circle around…

A: Whenever a reaction takes place there are reactants and they form products but in between, during…

Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…

A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: Are there any negative allosteric regulators for glycogen phosphorylase?

A: Glycogenolysis is a process of breakdown of glycogen. Glycogen phosphorylase is an enzyme that…

Q: Which of the following statements is FALSE regarding oxidative phosphorylation? The pH is higher in…

A: Cellular respiration is a collection of three metabolic pathways that generate ATP by oxidation of…

Q: 10. Which of the following statements regarding insulin is false? A. Insulin is a signal that…

A: When blood glucose concentration increases or decreases, carbohydrate metabolism is coordinated by…

Q: Is there a reason why you divided the pKa's by 2 when determining the pI?

A: Isoelectric pH or pI is the pH at which the amino acid or the peptide is in zwitterion state.…

Q: Which of the following statements concerning enzymes is TRUE? a. Enzymes can increase the…

A: Enzymes are biological catalysts that enhance the rate of biochemical reactions. The enzymes are…

Q: The mitochondrial matrix is home for the following: I. ribosomes II. circular DNA III. Kreb's…

A: Mitochondria is a membrane bound organelle which is also known as power house of the cell as it is…

Q: TABLE 3-1 Properties and Conventions Associated with the Amino Acids pk, values Amino acid…

A: pI refers to the isoelectric point or the pH at which the amino acid carries a positive charge and a…

Q: Q6.1: Three critical features of enzyme structure and function contribute to the overall efficiency…

A: The enzymes are biological catalysts that increases the rate of biochemical reactions. The enzymes…

Q: Which of the following are characteristics of animal cells? Select the correct response(s): Their…

A: Centrioles are cylindrical organelles in animal cell. 2 centrioles combine perpendicularly to form a…

Q: What is the total yield of NADH, FADH2, and acetyl-CoA from the complete oxidation of myristate?…

A: Myristic acid is a fatty acid with 14 carbon atoms. Beta-oxidation is the oxidation of fatty acid on…

Q: 5) Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between…

A: DNA Polymerase and Ligase are the two classes of enzymes that take part in DNA replication and…

Q: Among the given statements, which are characteristics of plant cells? Select the correct…

A: Plant cell has Cell wall as the outermost layer. Cell wall being the outermost layer surrounds the…

Q: 13. Discuss the energetics of High energy molecules that carry phosphates and provide an example of…

A: Cellular metabolism is made possible due to the participation of high energy molecules. The purpose…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

Please help

C. Even in automated sequencing, where you can include all 4 ddNTPs in one reaction, you
need to include "normal" dNTPs as well as the ddNTPs - why are these necessary? Why can't
you just put in the ddNTPs, since you've got all four of them available to the DNA polymerase?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

How would you approach this problem? You plan to sequence the following DNA by Sanger sequencing. Your reaction includes your sequencing primer (5' is on the left) and template DNA (5' end is on the left), dNTPs, buffer, DNA polymerase and the following fluorescent ddNTPs: red ddGTP, green ddATP and blue ddTTP. Sequencing Primer: CCGCCGGGCCCCAT Template to be Sequenced: GAGCGGCGGGCTGAGTAGCTCGCCGCGGGGATGGGGCCCGGCGGATT
1d) Whether done manually or automated, DNA sequencing gels are always made of polyacrylamide rather than agarose. Why can't agarose be used for a sequencing gel, as it is for other DNA gel electrophoresis?
Can you help with 1a please HELPFUL INFORMATION: When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. 1a. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?
5'-[seq]-3' The diagram shows the results of gel electrophoresis for Sanger sequencing. The wells are represented by open boxes and the DNA bands are represented by black boxes. The wells are labeled to show which dideoxy reaction was loaded into each. Write the sequence of the original template strand used for this sequencing reaction, with the 5’ end on the left and the 3’ end on the right.
During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicase
DNA Profiles as Tools for Identification A PCR-based paternity test is conducted using STRs that consistently produce a unique DNA fragment pattern from a single chromosome. Examining the results of the following Southern blot, which male(s) can be excluded as the father of the child? Which male(s) could be the father of the child?
BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would be created by cutting the normal gene with BamHI?
How would I solve this? primer (5’ TCAAAACG 3’ ) is shown hybridized to its template DNA below. Let’s say this DNA is used in a Sanger Sequencing reaction. How long (in nt) will dev the shortest RED nucleic acid chain be given that the red fluorophore is attached re to the ddCTP?
Even in automated sequencing, where you can include all 4 ddNTPs in one reaction, you need to include "normal" dNTPs as well as the ddNTPs - why are these necessary? Why can't you just put in the ddNTPs, since you've got all four of them available to the DNA polymerase?
Can you please help with 1a please picture with 1 graph is for question 1a) picture with 4 graphs is for question 1b) 1a) E. coli DNA and binturong DNA are both 50% G-C. If you randomly shear E. coli DNA into 1000 bp fragments and put it through density gradient equilibrium centrifugation, you will find that all the DNA bands at the same place in the gradient, and if you graph the distribution of DNA fragments in the gradient you will get a single peak (see below). If you perform the same experiment with binturong DNA, you will find that a small fraction of the DNA fragments band separately in the gradient (at a different density) and give rise to a small "satellite" peak on a graph of the distribution of DNA fragments in the gradient (see below). Why do these two DNA samples give different results, when they're both 50% G-C? 1b) If you denatured the random 1000 bp fragments of binturong DNA that you produced in question 1a by heating them to 95ºC, and then cooled them down to 60ºC and…
Following base removal, DNA polymerase can add nucleotides in the 5'-to-3' direction. Is that true or False? Why? please help me explain that
Sliding-clamp proteins load polymerase onto the primer and maintain its stable association with the template. true or false? DNA polymerases add a deoxyribonucleotide triphosphate to the 3' hydroxyl group of a growing DNA chain (the primer strand). true or false?