Answered: teeth of Turkana Boy

Science

Biology

teeth of Turkana Boy

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter15: Animal Evolution

Section: Chapter Questions

Problem 7SQ

See similar textbooks

Related questions

Q: How does breast development differ between adult men and women?

A: Introduction Humans belongs to class Mammalia. Means they have mammary glands to feed their young…

Q: When do females form all their ova (eggs)? At stage of Meiosis I are they halted? Can the life style…

A: The oogenesis is the process by which ova (singular- ovum) are produced in the ovary of female body.…

Q: what control measures have been put in place to help caulerpa taxifolia

A: Introduction Caulerpa taxifolia is a marine green macro-algae found in the Indian, Atlantic, and…

Q: Neanderthals DNA and behaviors show uS the ways in which they adapted to their environment over…

A: Introduction:- The process of development of present day Homo sapiens through different stages like…

Q: Which carbohydrate is NOT produced in the pentose phosphate pathway? glyceraldehyde 3-phosphate…

A: Introduction: The pentose phosphate pathway (also known as the phosphoglycerate pathway, pentose…

Q: Various options are provided as possible answers to the following questions. Choose the correct…

A: Introduction: The quantity of genetic traits (alleles and genotypes) present in a species is…

Q: List the derived traits in the angiosperm that make it MOST adapted to life on land, and describe…

A: Angiosperms are also known as “flowering plants”. The majority of plants on Earth are angiosperms,…

Q: What is normal or “healthy” vital capacity? How do these vital capacities compare to an unhealthy or…

A: Breathing is the most vital physiological processes in our body. We take in oxygen and give out…

Q: What other approaches can be used to determine protein concentration?

A: Introduction : Proteins are nitrogenous organic substances made up of one or more elongated chains…

Q: Define the normal age range for the onset of puberty.

A: When a boy or girl reaches puberty, they reach sexual maturity. It results in bodily changes and…

Q: Draw one red blood cell and at one white blood cell. Label the cell membrane, cytoplasm, chromatin,…

A: Red blood cells are biconcave discs( Round, flat and indented at the center) that lack nucleus. They…

Q: Answer briefly and concisely. Thank you! What have you observed regarding the brightness of the…

A: A microscope is a laboratory instrument used to examine objects that are too small to be seen by the…

Q: Nitrogen fixation is the reaction of: conversion of gaseous N2 into a biologically useful form of…

A: Q. Nitrogen fixation is the reaction of: a)conversion of gaseous N2 into a biologically useful form…

Q: Several calibration curves were created for a series of protein standards of known molecular mass…

A: Introduction :- Chromatography is a laboratory method used in chemical analysis to separate a…

Q: 3. The following descriptions are for the components of oxidative phosphorylation. List the name of…

A: The Kreb’s cycle, the electron transport chain and the process of glycolysis are the most crucial…

Q: Recognize the following types of biomolecules when given images such as the ones below and on the…

A: Biomolecules are the molecule which is present in living system mainly mafe up of carbon , hydrogen,…

Q: Q8.A. Use Punnett square method to show the inheritance of deafness (d) which is inherited as a…

A: Introduction : Inheritance refers to the transmission of various traits from one generation to the…

Q: . In DNA amplification, using the Taq polymerase, what is the maximum number of amplification…

Q: Biodiversity hotspotsa. have few populations because the temperature is too hot.b. contain about 20%…

A: A biodiversity hotspot is a region with a high concentration of endemic species, that is, species…

Q: Determine the advantages of phage therapy over antibiotict herapy.

A: The virus known as a bacteriophage assaults bacteria, hence the name. Phage means "to devour," hence…

Q: A plasmid comprised of B-DNA changed its linking number from 550 to 502, resulting in a superhelix…

A: A plasmid is a small extrachromosomal DNA molecule within a cell that can replicate independently of…

Q: Make a claim regarding the decreasing deforestation of the Brazilian rainforest from 2001-2013. Cite…

A: Deforestation is the purposeful clearing of forested land. Throughout history and into modern times,…

Q: Male: AA x Female: aa male A female a a Male: pp x Female: Pp male female P P A P P genotypes number…

A: Punnett squares give information about the proportion of possible genotypes from a cross.

Q: Question 5 5. Nitrogenous bases pair with bases that are O available O identical complementary O…

A: DNA is a double helical structure that contains phosphate groups, pentose sugars, and four nitrogen…

Q: Explain how mutations in the following proteins might result in either loss of responsiveness to a…

A: Introduction Mutation is a sudden heritable change in our genome or genetic material. Mutation can…

Q: V. Materials. To be procured by each student: Genetic code VI. Procedure 1. Assume that a segment of…

A: DNA strand "A" = 5' TTCTTGTCATACTGCTGGCTGCCCCACCAGCGAATGGTGACAAACAAG 3' Note:-i answer according to…

Q: How many new viruses emerge every day

A: The living organisms on this planet can be categorized broadly into three groups - Plants, Animals…

Q: There is no bird without feathers. A. true B. false

A: Birds: A class of warm-blooded animals known as the Aves, birds are distinguished by their feathers,…

Q: how bacteria can be used as biosensor to detect cancer causing chemical (carcinogenes) environmental…

A: Biosensor are biochemical devices which meansure bioloical and chemical reactions by generating…

Q: Define biology

A: Science is the study of nature, the way natural things behave, and how they actually work in the…

Q: What is Wilms tumor and what cellular components are involved?

A: A mass of tissue that develops abnormally when cells do not die on schedule or expand and divide…

Q: How can the cell in our body organize into functional structure?

A: Human body can be compared to a complex machine. In all these aspects, the human body is much like a…

Q: . What is science ? A. Study of living things B. study of nature C. Study of law D. All of the above

Q: Please draw the protein synthesis

A: Introduction Protein synthesis, also known as protein biosynthesis, is a fundamental biological…

Q: Mention the chemical change that proinsulin undergoes, to be able to act as mature insulin.

A: Pancreas is considered as both exocrine as well as endocrine gland. As an exocrine gland , it helps…

Q: Explain how genetic evidence from the Neanderthal genome helps paleoanthropologists understand their…

A: While DNA can be used to understand aspects of biology and evolution, the fact that DNA is a fragile…

Q: The controlled exposure condition applies to the general public with no time restrictions. Select…

A: Controlled exposure means exposure to various ionizing radiations that include X-rays, gamma rays or…

Q: What is homo sapiens?

A: Homo sapiens is the scientific name for the modern human beings which are a primate species. The…

Q: Explain how your body monitors its hydration levels

A: Introduction: waste products can be dissolved in water, which then allows them to leave the body…

Q: How many gametes does the male produce per day? The female per month? How does this help in the…

A: INTRODUCTION Male gamete : sperm, 200-600 per ejaculation. Female gamete : ovum, one in each month.

Q: d Kingdom) 3. A 3-year-old child was brought to the emergency by her parents because of fever and…

A: Introduction:- Infection is caused by different microorganisms like bacteria, viruses and parasites.…

Q: Question 1 of 10 What enables a whale to move its fins in the ocean? A. Energy from the rotation of…

A: C. Energy directly from its food, enables a whale to move its fins in the ocean. The energy to…

Q: In the extracellular phase, HIV is considered to be infectious Oparasitic Olysotropic O symbiotic O…

A: Initially HIV infect T cell and macrophage directly or is carried to these cell by langerhans…

Q: 1. Seeking shelter from the cold is an example of a(n). O O O 01:Pretest NPS Credit Recovery HS:…

A: Here i discuss about the seeking shelter from cold. Body temperature can be maintained by behavioral…

Q: The result Jack obtained after transforming his competent Escherichia coli cells with plasmids is as…

A: Plasmid It is small, circular, and double-stranded DNA that is found in bacterial cells and in some…

Q: Question 1 Which structure is correctly paired with its tissue system? root hair-vascular tissue…

A: Vascular tissues are complex conducting tissues in higher plants made up of various cell and element…

Q: List two typical complications of urinary tract obstruction, and briefly describe them.

A: A obstruction in one or both of the tubes (ureters) which transport urine from the kidneys to the…

Q: In endosymbiotic theory, host cells were believed to have ingested smaller individual photosynthetic…

A: Endosynotic theory is a theory which explains the evolution of a Eukaryotic cell from a primitive…

Q: Determine the method of distinguishing whether the bacteria has penicillinase activity or if the…

A: Penicillin works by preventing the manufacture of peptidoglycan, which is a crucial part of both…

Q: what is the correct order of the phases of an action potential

A: Introduction: The resting membrane potential, often known as the resting potential, is a voltage…

Concept explainers

Human Evolution

Human evolution is the process of evolution of humans from early man to anatomically modern humans. The process of evolution in humans leads to the gradual development of traits like bipedalism. Humans are the highly social animals that make them the most advanced animal on Earth. Human evolution is an outcome of interaction among the following processes:

Question

100%

explain how microscopic examination of the teeth of Turkana Boy (Nariokotome Boy) sheds light on the maturity patterns in Homo erectus, compared to Homo sapiens

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Many zoologists consider mammalian teeth, rather than endothermy, hair, or lactation, to be the characteristic most responsible for success of mammals. Explain why this could be true
Describe the behavioral and technological advancements of Homo erectus and their significance.
How do the canine teeth differ between Australopithecus africanus and Homo sapiens
Name three “unique” characteristics observed in the dogfish shark and explain how these features make the shark better suited to succeed in its environment or as a predator.
Explain why an understanding of bipedalism and brainsize is important in understanding the evolution of thehominins.
These teeth, which are very large and used for display and intimidation in chimps and gorillas, dramatically decreased in size in hominins. while these teeth are strongly sexually dimorphic in chimps and gorillas, they are not so in hominins. what are these teeth called?
Describe three derived characteristics of mammals which are advantageous to the occupation of a variety of habitats. Identify three novel characteristics that distinguish hominins from other apes and mammals.
Define “diphyodont” and “heterodont” and explain why both terms apply to mammalian dentition.
What is distinctive about each of the following: horns of bovids, antlers of deer, and horns of rhinos? Describe the growth cycle of antlers.
Contrast early development, including cleavage, in the echinoderm (or in amphioxus), the amphibian, and the bird, paying particular attention to the importance of the amount and distribution of yolk.
Why do you think the changes in Homo erectus with much larger body size, skull, and brain than Australopithecus occurred? How did these changes in physical appearance affect the behavior and survival of Homo erectus?
Describe the mating and breeding processes of sea lions.