Answered: What makes it possible for human…

Name: 39. What makes it possible for human mitochondria, which have only 22
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 39. What makes it possible for human mitochondria, which have only 22 sequences that code for tRNA, to translate mitochondrial polypeptides that require 32 tRNAs?

Science

Biology

What makes it possible for human mitochondria, which have only 22 sequences that code for tRNA, to translate mitochondrial polypeptides that require 32 tRNAs?

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 38CTQ: A scientist discovers a virus encoding a Protein X that degrades a subunit of the elF4F complex....

See similar textbooks

Similar questions

30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… d) Assuming the sequence above is a bacterial gene, identify the region encoding the Shine-Dalgarno sequence. e) What is the function of the shine Dalgarno sequence?
Contrast transcription and translation. Name at least three differences between the two processes.
A scientist discovers a virus encoding a Protein X that degrades a subunit of the elF4F complex. Knowing that this virus transcribes its own mRNAs in the cytoplasm of human cells, why would Protein X be an effective virulence factor?
Quinolone antibiotics treat bacterial infections by blocking the activity of topoisomerase. Why does this treatment work? Explain what occurs at the molecular level.
Alternative forms of a protein can be beneficial or harmful to a cell. What do you think would happen if too much of an alternative protein bound to the 3' UTR of an RNA and caused it to degrade?
A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
37. A portion of an mRNA attached to a ribosome reads: 5′ UUUGACCCCACG 3′ If a tRNA with an aspartic acid amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? What amino acid will be attached to the amino group of the histidine encoded by this mRNA?
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… b)Give the sequence and polarity of the mRNA encoding the polypeptide. Please explain step-by-step how exactly you go from the DNA sequence given to the final answer.
30. How can one identify the presence of introns in a hybrid of DNA and mRNA? Give an example of non-coding RNA and a regulatory DNA element.
38. in the human beta-globin, two introns are spliced out in order to produce the mature mRNA
38. Assume that the reading frame is from left to right and that the columns represent transcriptional and translational alignments. Use the provided Genetic Code table.
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… b)Give the sequence and polarity of the mRNA encoding the polypeptide.