The diagram below shows a hybridization experiment between aeukaryotic MRNA and the template strand of its gene. Which of thefollowing statements is FALSE?This gene contains four exons.The 5' end of the MRNA is on the left side.Hybridization of a prokaryotic MRNA and its DNA template strand willnot show loops of unpaired DNA.The gene's introns are visible as unpaired DNA loops.None of the above

Answered: The diagram below shows a hybridization…

The diagram below shows a hybridization experiment between a eukaryotic MRNA and the template strand of its gene. Which of the following statements is FALSE?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 8QP: The following segment of DNA codes for a protein. The uppercase letters represent exons. The...

See similar textbooks

Related questions

Q: Which of the following is a function of the 7-methylguanosine cap?a. Exit of mRNA from the nucleusb.…

A: Ribonucleic‌ ‌acid‌ ‌(RNA)‌ ‌‌are‌ ‌genetic‌ ‌material‌ ‌usually found in viruses and bacteria that…

Q: In which of the following would you find the start codon sequence of a gene? mRNA DNA and…

A: Codons are made up of three consecutive nucleotides. The sequence of start codon is AUG. It…

Q: Which of these are a DNA sequence are which are a protein? Column A Column B 1. A gene's promoter a.…

A: RNA polymerase - Enzyme used to convert DNA into mRNA. Introns - non-coding part of the gene. Exon -…

Q: Portions of eukaryotic mRNA sequence that are removed during RNA processing are ________. a. exons…

A: The genetic material of a cell or an organism refers to those materials found in the nucleus,…

Q: Bacteria Eukaryotes First amino acid 5' end 3' end Cistron Introns/exons

A: Bacterial and eukaryotic m-RNA is different from each other in bacterial translation first amino…

Q: Which of the following is a true statement concerning codons A codon Will be read by RNA…

Q: The sequence below is an mRNA strand that is in the cytoplasm ready to translated by a ribosome. If…

A: Translation is the process of formation of a protein chain from a RNA chain. Translation requires an…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Missense mutation is the mutation in which single amino acid change occurs. The other amino acid in…

Q: The following is a section of DNA removed from a cell nucleus: 5'…

A: The basic physical and functional unit of heredity is the gene. DNA is the material that makes up…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Mutation is the sudden change in the base pair of sequence resulting in altered phenotype. The…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: The following double stranded segment of DNA is part of a protein coding gene. The segments in…

Q: A small section of bacterial DNA template (anti-sense) strand has the following nucleotide…

A: The mutation is a sudden, stable, and heritable change in the organism’s genome. It can occur…

Q: Which of the following statements about the spliceosome is false? a. A spliceosome splices pre-mRNA…

A: For RNA maturation there are about 40 different types of proteins and small RNAs that are called sn…

Q: Which of the following is NOT found on a mature eukaryotic mRNA molecule? (Choose all that apply)…

Q: Refer to a genetic code table for the question. below is a portion of the template strand of a…

A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…

Q: Which of the following MRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…

A: The mRNA is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene.…

Q: The diagram below shows the result of a hybridization experiment between a eukaryotic mRNA and the…

A: The process of hybridization refers to the combination of two complementary single-stranded RNA or…

Q: Which of the following statements below is incorrect? * A. the genetic code is overlapping B.…

A: As per guidelines, you have asked multiple questions we will solve the first question for you. If…

Q: Which of the following units recognize UAG, UAA, and UGA codons? (Single answer) Elongation factors…

A: Genetic code is the combination of 3 nucleotide (called nucleotide triplet or codon) where each…

Q: Suppose that section x, y, and z of the following hypothetical DNA strand are the exon (coding…

A: Exons and introns are nucleotide sequences within a gene. Exons are the coding sections of a gene…

Q: How many bases would a mRNA have? if it was coded for a protein of 250 amino acids long? explain…

A: The flow of genetic information in a biological system is explained by central dogma and it involves…

Q: Choose the option that goes with the blank. The parentheses after the blank are the choices.…

A: In the process of synthesis of proteins from DNA, the information in DNA is used for the synthesis…

Q: In a short paragraph or two, contrast each of the following pairs of concepts: a. Compare the 5' and…

A: DNA is transcribed to form mRNA by transcription. The mRNA forms special structures and features at…

Q: Give 7 examples where a specific nucleotide sequences/elements are recognized by protein or…

A: Replication is the process by which new strands of DNA are synthesized from pre-existing DNA.…

Q: Could two mRNAs have different nucleotide sequences and yet code for the same protein? Explain your…

A: All humans are made up of numerous cells. Cells are the basic building blocks of an organism. Cells…

Q: A non-coding DNA strand has the sequence below: GTACCGATATAATCGGGCTA What is the MRNA sequence that…

A: Noncoding DNA sequences are DNA sequences that do not encode protein sequences in an organism.…

Q: Consider the following segment of a template strand of DNA: Part A -АТА AGC TTC GAC What is the MRNA…

A: Transcription is the process of making an RNA copy of a gene sequence known as mRNA by using DNA as…

Q: Explain (in one or two lines) the function of the followings:(a) Promoter(b) tRNA(c) Exons

A: The process of DNA based gene expression in which a particular sequence of DNA molecules are copied…

Q: The first column of the table below shows the beginning of a gene and five different mutations of…

A: Codon is a sequence of three nucleotides that codes for specific amino acid. Codons encode amino…

Q: You’re working in Marshall Nirenberg’s lab, trying to decipher the genetic code. You use several…

A: Marshall Nirenberg studied the genetic codes for protein synthesis in his biochemical research. He…

Q: Fill in the blank with the most appropriate term that is described by the following statement:…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: Which of the following is a function of the 7-methylguanosine cap? a. Exit of mRNA from the nucleus…

A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…

Q: What is the effect of the insertion of a nucleotide in the 4th codon of the DNA sequence below?…

A: There are two strands of DNA :- template and coding strand . Template strand read in 3' to 5'…

Q: Below is an electron micrograph illustrating the process of simultaneous transcription and…

A: Prokaryotic cells are unicellular and they lack a nuclear membrane. Due to this, transcription and…

Q: Explain the three steps (Codon recognition, peptide bond formation, translocation) in elongation…

A: The translation is the biological process that involves the conversion of the genetic information in…

Q: Which of the following would be present in a genome but not the transcriptome? (Select all) A)…

A: A transcriptome is the complete range of messenger RNA, or mRNA, molecules displayed by an organism.…

Q: In the image below, what is the C label pointing to?

A: The above image represents transcription where the RNA polymerase move along the DNA and make the…

Q: Here is a schematic map with a scale of a eukaryotic gene. How long is the primary mRNA transcript…

A: The mRNA is produced by the process of transcription.

Q: Which of the following is NOT a protein that aids the ribosome during translation? Question 28…

A: Translation is a process through which polypeptide chains or proteins are synthesized from mRNA with…

Q: Which of the following is responsible for creating the covalent bonds that link the amino acids of a…

A: RNA stands for ribonucleic acid which plays a key role in the metabolic processes for all steps of…

Q: Given: eukaryotic cells can make different proteins, using only one gene. How can a eukaryotic cell…

A: Genetic material in eukaryotic cells is DNA present inside the nucleus. DNA is transcribed to form…

Q: What happens when one base pair of DNA is lost from the coding region of a gene because of mutation?…

A: This type of mutation is known as Deletion mutation in which a single or entire sequence of…

Q: What strand of mRNA would be synthesized from a template DNA strand with the sequence GATGTTTAC…

A: The information from the DNA is transferred to RNA by transcription. The information present in the…

Q: Which two of the following statements about transcription are true A. Transcription makes an RNA…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Below is a representation of a pre-mRNA. Numbers represent exons, and letters represent introns:…

A: Transcription is a process through which the doucle stranded DNA transcribes itself into a single…

Q: A DNA template strand having the sequence shown below would produce an mRNA molecule with that with…

A: DNA gets transcribed into mRNA by using RNA polymerase enzyme. mRNA is single stranded and DNA is…

Q: Of the following, which is a modification made to the pre-mRNA of eukaryotes before translation?…

A: According to the central dogma the genetic information stored in the form of DNA is first converted…

Q: the coding strand of DNA has the same sequence as the mRNA, except that there are U’s in the mRNA…

A: an delete the 'C' at position 52 Explanation: it is the type of frameshift deletion mutation…

Q: Which of the following would not be found in a mature mRNA in a eukaryotic cell? A Star Codon B…

A: Select the component that is not present in mature mRNA of eukaryotic cells. The given options areA.…

Question

The diagram below shows a hybridization experiment between a
eukaryotic MRNA and the template strand of its gene. Which of the
following statements is FALSE?
This gene contains four exons.
The 5' end of the MRNA is on the left side.
Hybridization of a prokaryotic MRNA and its DNA template strand will
not show loops of unpaired DNA.
The gene's introns are visible as unpaired DNA loops.
None of the above

Expert Solution

Step 1 This is an R loop hybridization experiment.

It was performed using both the cytoplasmic RNA (ribonucleic acid) and nuclear pre-mRNA (messenger ribonucleic acid). The results from these experiments showed that the eukaryotic DNA (deoxyribonucleic acid) contains introns/intervening sequences which are excised from the primary transcript of mRNA. This takes place during the processing of the primary transcript to form the mature mRNA.

Step by step

Solved in 2 steps

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
A scientist observing a cell during gene expression would be able to easily distinguish it as a prokaryotic cell by which of the following observations? Group of answer choices as soon as the DNA introns are removed from the template after the 5' caps are converted to mRNA after a transcription initiation complex has been formed during transcription once the pre-mRNA has been converted to mRNA 2.Scientist wanted to determine what molecule held the ‘gene ‘ if they did a study in which a cell was infected by a virus,which part of the virus actually caused the infection inside the cell!? -Dna -ribosome -protien -Rna
Which of the following is true about the three major classes of RNAs in the cell: mRNAs, tRNAs, and rRNAs? A. mRNAs encode polypeptide chains. B. tRNAs are structural components of the ribosome. C. rRNAs are adapter molecules that translate the information on an mRNA into a polypeptide sequence. D. mRNAs can also encode tRNAs and rRNAs.
The diagram below shows the result of a hybridization experiment between a eukaryotic mRNA and the template strand of its gene. Which of the following statements is TRUE? a. This gene contains four exons. b. The gene’s exons are visible as unpaired DNA loops protruding from the DNA/RNA hybrid. c. The 5’ end of the RNA strand is on the right side of the drawing. d. A hybrid between a prokaryotic mRNA and its gene would result in a similar image. e. the poly-A tail of the mRNA hybridizes with a poly-T stretch in the DNA.
Consider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During RNA transcription, this double-strand DNA molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. _____________ is the template strand for the synthesis of RNA? The sequence of the newly transcribed mRNA is _________________. Question 5 options: The top strand, 5'...GACUGUCAGUCA...3' The bottom strand, 5'...ACUCACUCUCAG...3' The top strand, 5'...UGACUGACAGUC...3' The bottom strand, 5'...GACUGUCAGUCA...3'
Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of 2 introns. Show what the final mRNA would look like. 5’ ATTTGCG*AATGAGAGTCC*GCATTACGATG“CAATGCAGTG”TTTAAGCGCGCATTAA 3’
A DNA template strand having the sequence shown below would produce an mRNA molecule with that with what sequence? 3’CGATCA-5’
If a change in a DNA sequence occurred, could that affect the mRNA? Why or why not? Group of answer choices 1. no because the mRNA is not identical to the DNA 2. no because the mRNA does not need the DNA to be made 3. yes because the mRNA is made using the DNA as a template 4. yes because the mRNA is identical to the DNA
Why do prokaryotic organisms translate mRNA molecules while being transcribed? Group of answer choices Prokaryotes lack nuclear membranes to separate DNA and mRNA from protein-synthesizing equipment. Prokaryotes use reverse transcriptase to simultaneously translate and transcribe mRNA. Prokaryotes use pre-mRNA to translate, while transcription occurs within the cell. Prokaryotes have functional mRNA that yields portions of the transcribed mRNA into the cytoplasm to allow for translation to occur.
Which of the following is the definition of a gene? RNA that delivers amino acids to a ribosome during translation RNA that carries a protein-building message A unit of information encoded in the sequence of nucleotide bases in DNA The RNA component of ribosomes
Which of the following statements is TRUE? Group of answer choices The human DNA is single-stranded and both strands serve as a template for transcription. In some cases, mRNA can be converted into a double-stranded DNA. All statements are true. The mRNA molecule attaches to ribosomes during transcription. Ribosomes are made up of tRNAs.
mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built. It is important to understand the relationship between the following nucleic acids: DNA template and mRNA strands are ANSWER (the same or complementary) DNA template and tRNA anticodon strands are ANSWER (the same or complementary) DNA non-template and mRNA strands are ANSWER (the same or complementary) DNA non-template and tRNA anticodon strands are ANSWER (the same or complementary) DNA template and DNA non-template strands are ANSWER (the same or complementary) mRNA and tRNA anticodon strands are ANSWER (the same or complementary)