Portions of eukaryotic mRNA sequence that are removed during RNA processing are ________. a. exons b. caps c. poly-A tails d. introns

Q: Translation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: If a mutation deletes the start codon in a eukrayotic gene, which of the following most accurately…

A: The start codon is a three-nucleotide long sequence in a gene that is responsible for the initiation…

Q: If a mutation deletes the promoter in a eukrayotic gene, which of the following most accurately…

A: mRNA means messenger RNA. mRNA forms from the template DNA strand. The template DNA strand is used…

Q: Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red…

A: Red blood corpuscles (RBC) are the cells that carry oxygen thorough out the body. They are small…

Q: The Kozak rules determine a. the choice of the start codon in complex eukaryotes. b. the choice of…

A: Eukaryotic mRNA (messenger ribonucleic acid) can have multiple AUG (start codon) sequences on it.…

Q: Explain why cell biologists predicted that the genetic code would be based on a 3-base codon.…

A: The genetic code is the precise sequence of DNA nucleotides read as three-letter words or codons…

Q: If the template strand of DNA has the sequence 5'AATGCCTATA3', the MRNA sequence that is transcribed…

A: Transcription is the first of several steps in gene expression in which a particular segment of DNA…

Q: Two eukaryotic proteins have one domain in common but areotherwise very different. Which of the…

A: Eukaryotes are organisms whose cells have a nucleus enclosed within a nuclear envelope. Eukaryotes…

Q: The anticodons are located in a.tRNA. b.rRNA. c.mRNA. d.ribosomes. e.endoplasmic reticulum.

A: Anticodons- An anticodon is a trinucleotide sequence complementary to that of a corresponding codon…

Q: Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What…

A: Gene expression is the process by which the instructions in our DNA are converted into a functional…

Q: In Eukaryotes, DNA is a long molecule inside a tiny nucleus. a. How can this long chain fit in such…

A: DNA (deoxyribo nucleic acid) is genetic material of the cell. In case of eukaryotes, DNA is…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide…

Q: The portion of the mRNA that is removed during splicing is (a) an inverted repeat (b) the promoter…

A: The protein synthesis is a process which involves two steps transcription and translation .…

Q: Where in a gene would a 4-bp insertion mutation havethe least effect on gene expression?a. Intronsb.…

A: Mutation is defined as the change in genetic makeup triggered by natural or man made processes. The…

Q: A mutation occurs that alters the third base in an mRNA codon from a C to a G. This mutation is most…

A: Mutation is defined as the change in the DNA sequence. This can occur either during the DNA copying…

Q: o In Prokaryotes, what is the function of the 5'UTR? A. It contains the start codon It contains the…

A: The 5′ untranslated region (5′ UTR) is the region of an mRNA that is directly upstream from the…

Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…

A: BASIC INFORMATION  TRANSLATION  It is the process in which protein is which formed from the…

Q: The wobble position of codons occurs A. before the 2nd base B. after the ribosome initiates a stop…

A: Question - The wobble position of codons occurs A. before the 2nd base B. after the ribosome…

Q: During translation, when a stop codon is read on the mRNA strand at the ribosome...  a the mRNA is…

A: Activation (getting ready), initiation (getting started), elongation (getting longer), and…

Q: Some events that take place in proteins synthesis are shown below: A. An enzyme reads the gene…

A: TRANSCRIPTION It is the process of transfer of sequence information from DNA  to RNA . The DNA…

Q: The portion of the mRNA transcript that gets removed duringRNA processing is thea. exons.b.…

A: Ans: RNA processing: The post transcription processing in eukaryotes is referred to as RNA…

Q: A nonsense mutation in a gene:   A. introduces a premature stop codon into the mRNA   B.…

A: Any permanent change or alteration occurred in the DNA sequence is termed as the genetic mutation.…

Q: For translation of eukaryotic mRNA sequences: a) The stop codon stops translation by blocking the…

A: Translation refers to the process of polymerisation of amino acid to form a polypeptide. The order…

Q: Which of the following mutations is likely to be the least harmful? A. A +1 frameshift mutation B.…

A: ANSWER;-  B). A +3 frameshift mutation Explain;- A frameshift mutation is a type of mutation…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Why might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic…

A: Single base pair mutation in mRNA transcript in Eukaryotes is less serious because mRNA of Eukarotes…

Q: Which of the following functions is NOT typically attributed to small nuclear RNA (SNRNA)? A)…

A: Ribonucleic acid is a complex of the high molecular weight molecule that participates in cellular…

Q: Which two sequences shown in the diagram are NOT directly transcribed from the template strand of…

A: ANSWER - in this figure the following sequences are not directly transcribed from the template…

Q: Use your genetic code (codon) table to answer the next two questions: What type of mutation would…

A: The answer to the above question is given below.

Q: Which is true about eukaryotic cDNA? Choose all that apply a. it is single stranded b. it is made…

A: Complementary DNA is abbreviated as cDNA. This form of DNA has a wide range of applications. Genes…

Q: A scientist sequencing mRNA identifies the following strand:…

A: mRNA is termed as messenger RNA. It is a single stranded RNA used in the synthesis of protein.mRNA…

Q: Transfer RNA ____________________. a. Carries amino acids to the ribosome b. Carries information…

A: The RNA is a biopolymer and the existence of complementary sequences on the RNA strand ensures that…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: Transcription is the process in which RNA is synthesized from DNA.

Q: Consider the following gene with their respective introns and exons   5’ –…

A: Since you have asked multiple questions, we will solve the first three question for you. If you want…

Q: Missense mutations   a create premature stop codons   b cause no change in a gene product   c…

A: A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is…

Q: a. Identify the sequence that was mutated by the scientists and explain your reasoning. b. What…

A: Ans) a)A mutant protein is the protein product encoded by a gene with mutation. Mutated protein can…

Q: Which of the following help(s) to stabilize mRNA by inhibiting degradation?   a. Introns   b.…

A:

Q: Given the following DNA sequence from the template strand of a given gene:…

A: Codon is a  sequence of three nucleotides which together form a unit of genetic code in a DNA or RNA…

Q: Below is a picture of multiple mRNA molecules being transcribed simultaneously from the same…

A: mRNA transcription and translation occurs at same time in prokaryotes(polycistronic) while in…

Q: A given coding strand sequence in a Eukaryote is as follows 5'GGGAATATAA GACCGATGGA GGGTACAG…

A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…

Q: tRNAs a. carry amino acids b. bind to the anticodon present in the mRNA c. adapt the genetic…

A: Introduction Transfer RNA (tRNA) is a short RNA molecule that aids in the production of proteins. A…

Q: _______is/are removed from a new mRNA. a. Introns c. A poly-A tail b. Exons d. Amino acids

A: Nucleic acids are macromolecules. These are of two types - Deoxyribonucleic acid (DNA) and…

Q: Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of…

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…

Q: Which mutation changes a normal codon to another codon specifying the same amino acid a. directed b.…

A: Any change in the base pair of the sequence of base pairs that are present in the nucleic acid…

Q: .   To attach to viral sequences   b.   To weigh down mRNA   c.   To terminate translation…

A: The purpose of a Poly-A tail being added to mRNA is to terminate translation. The polyA tail is a…

Q: Which of these features is found in eukaryotes but not bacteria?a. polygene mRNAs b. introns c. stop…

A: Living organisms are primarily classified as prokaryotes and eukaryotes. Prokaryotic organisms like…

Q: The role of transfer RNA (tRNA) is to match a codon (3 bases) in mRNA sequence to:   A. An amino…

A: The process of protein synthesis is also known as translation. It is possible with the help of…

Q: If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the…

A: DNA strand – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…

Q: Of the following, which is a modification made to the pre-mRNA of eukaryotes before translation?…

A: According to the central dogma the genetic information stored in the form of DNA is first converted…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.