The egg of a fish is what type of chordate egg and why? a. isolecithal b. telolecithal with total cleavage c. telolecithal with meroblastic cleavage

Q: Meaningful evolution occurs when __________. ○ a heritable trait affects survival and fitness ○ a ...

A: Evolution is the change in the characteristics of a species over several generations and relies on t...

Q: Select all the characteristics that apply to BACTERIA but not Eukaryotes. □ lack membrane bound-org...

A: Introduction: Bacteria is a single celled prokaryotic organism. Their cell structure is simpler than...

Q: 1. define inheritance, genes, alleles, and other basic terms used in genetics. 2. execute the basic...

A: It was during the mid-nineteenth century that headway was made in the understanding of inheritance. ...

Q: Human somatic cells have 46 chromosomes. Are the cells different in any way from the parent cell and...

A:

Q: If the purity of DNA sample is below 1.8 A260/A280, where did the protein contamination come from?

A: The absorbance ratio at 260 nm & 280 nm is used to determine the quality of DNA & RNA.  A ra...

Q: Describe safety measures put in place for genetic modification.

A: The Food and Drug Administration (FDA), Environmental Protection Agency (EPA), and Department of Agr...

Q: Which of the following are incapable of undergoingmitosis?a. osteoblasts and osteoclastsb. osteocyte...

A: Introduction: Bone tissue is composed of four types of the cells which are osteocyte, osteoblast, os...

Q: Compare the structures of DNA and RNA.

A: Nucleic acids are the most important organic compounds found in all living beings. The three major c...

Q: Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical pro...

A: ANSWER;-  Forward primer:Sequence = 5'-CT-GAATTC-ATGGCTAAAGGCGGAGCT-3'Length = 18 ntdGC content = 56...

Q: Why are the elements found in the I=P x A x T important in terms of them having an impact to our env...

A: Any organism cannot survive in isolation. It is surrounded by a number of biotic and abiotic factors...

Q: are the gene pairs in non allelic interaaction, recessive epistasis independently segragating?

A:  Epistasis:The interaction of genes that influence phenotype" Epistasis is a phenomenon in genetics ...

Q: In your own words, kindly give the function and allowable limit (if applicable) of each of the follo...

A: Beef cubes- Beef cubes are high in protein and helps to build muscle. It prevents iron deficiency an...

Q: Explain the concept of electrophoresis.

A: Introduction Genetic engineering is the process of altering an organism's genetic makeup using recom...

Q: Q6.1. What is the founder effect? Sampling error that occurs during the establishment of a new popul...

A: Introduction :- The founder effect is the loss of genetic variation that happens when a new populati...

Q: Question 5

A: Answer to Question 1: - Sequence of passage of molecule for filtration in kidney: - Blood> Capill...

Q: If Marine communities dominated during the Early Paleozoic, why move to land? What would an organis...

A: Paleozoic era was a major interval of geologic time that began 541 million years ago and ended about...

Q: 3. Cross a man with type B heterozygous blood with a woman with type O blood. What are the possible ...

A: ABO blood group is an example of multiple allelism. Co dominance are also seen in blood types when b...

Q: you were trying to locate where a gene resided on a chromosome, you would be looking for the gene's ...

A: Phenotype is the expressed character trait of an organism Allele is the genetic equivalent of a trai...

Q: 3. Repeat steps I and 2 for an ear of corn that is the result of crossing Homozygous dominant and he...

A: Mendelian inheritance, or Mendelism, is a collection of hereditary notions proposed in 1865 by Grego...

Q: You have a precursor protein that is translated in the cytosol with an N-terminal mitochondrial loca...

A: The mitochondria is a double membrane bound cell organelle that is responsible for energy (ATP) prod...

Q: Humans have respiratory structures from the gut, for fishes, they’re not.

A: The respiratory system of humans consists of, nasal cavity, trachea( wind pipe) , the main bronchus,...

Q: The part of the neuron that is usually highly branched and receives input from other neurons is the ...

A: Neurons are a particular form of cell that carry information messages or signals to and from the bra...

Q: A red blood cell passes by a cell that has done cellular respiration and, therefore, has a high conc...

A: Hemoglobin can be defined as the protein that is present in the blood and is responsible for the tra...

Q: Describe briefly these cells and identify their shapes. The yellow one is the bone under LPO, and th...

A:

Q: Which of the following statements about the mechanism of splicing is correct? 1. A mutation in a 5' ...

A: The mRNA that is produced by the process of transcription undergoes a modification process in order ...

Q: Trace the flow of hormanes in the adaptive thermoregulation response involving brown adipose tissue....

A:   In thermogenesis the production of heat energy in brown any post issue is a component of the homeo...

Q: Some people declare that we shouldn’t worry about endangered species because extinction has always o...

A: Endangered species are those that are thought to be in grave danger of extinction in the wild. Emerg...

Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a...

A:   Here,  human DATP gene sequence of human is given , i.e :  ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC

Q: There are two types of alleles: Type B1 and Type B2 (In total there are 10) Type B1 has 6 Type B2 ha...

A: Introduction : Here,  B1 allele = p = homogygous dominant allele              B2 allele = q = homogy...

Q: 22

A: Motor neurons are components of peripheral nervous system which conduct efferent impulses from the s...

Q: 1. What is an exocytosis? 2. What is an endocytosis? 3. Explain the types of endocytosis and give ex...

A: Hello, thank you for your questions. But following the guidelines we are providing the answers for f...

Q: A population ecologist might study the effect of an introduced predator on the _________ of particul...

A: Introduction: A predator is an animal that kills and eats other animals. Examples of predators are l...

Q: Research have stated that there are factors that could affect the efficacy and duration of mosquito ...

A: *Mosquitoes are vectors for mamy diseases like malaria and chikungunya abd Zika virus and yellow fev...

Q: Choose any microorganism from the different groups of cellular and acellular and give the scientific...

A: Introduction:- Bacteria, fungus, archaea, and protists are examples of microscopic creatures. Microo...

Q: How are the concepts of "proxy" and "analogy" similar, and how are they used in reconstructions of t...

A: Proxy or equivalent term homologous is a structure inherited from a common ancestor. Analogy or anal...

Q: What is the importance of water, carbon and nitrogen for living organisms? Explain briefly.

A: Importance of water for living organisms:-  All animals and plants need water to survive, and the hu...

Q: Consider the following F, individuals in different snapdragon species and the F2 ratios produced by ...

A: "Genetics" is the study of the functioning and main codes of variation and heredity. Inheritance is ...

Q: 8. Which of the following is the longest entity O reads contigs O scaffolds O bases

A: These options represent the various size of base sequences. 

Q: why are gram-negative bacteria unevenly distributed on a slide?

A: why are gram-negative bacteria unevenly distributed on a slide?.   Introduction: Bacteria that do no...

Q: Myosin heads bend when attached to actin

A: Correct option is C  Myosin heads bend when attached to actin  

Q: If one bit is mutated on the chromosome 11010001, which of the following chromosomes cannot be gener...

A: * Mutations means change in a DNA sequence by altering the bases. *Mutations arise due to mistakes m...

Q: 1. Read the paragraphs below. For each paragraph, write the letter of the diagram from the diagram s...

A:

Q: In a generalized-transduction experiment, phages arecollected from an E. coli donor strain of genoty...

A: Part A. In the question given that - "initially the treated recipient populations placed on a minima...

Q: Suppose a population has two alleles at a particular locus, and individuals with different diploid g...

A: Hardy Weinberg’s principle is the mathematical representation of population analysis which calculate...

Q: Protoceratops how did they defend itself from predators? They hornless Dino and very small. So what ...

A: Protoceratops can be referred to as herbivorous dinosaur that possessed four limbs and was an ancest...

Q: Explain how FRET could be used to monitor the association of Gαs and adenylyl cyclase following acti...

A: How does fret, a sort of fluorescence can be utilised to essentially check Its interaction of the Ga...

Q: During the Paleozoic, many life forms developed hard parts (shells/bones/etc.).  Why would it be use...

A: Shelled animals, the majority of which are sea-based, come in a wide range of shapes and sizes. Beac...

Q: _1. It is the important organ that controls thought, memory, emotion, touch, motor skills, vision, b...

A:

Q: During pregnancy, the fetal circulatory system works differently than after birth.  Answer the foll...

A: Ductus arteriosus, ductus venosus and foramen ovale get closed and transformed into newborn circulat...