The figure above represents changes in different types of metabolic pathways (y-axis) as energy charge in a cell (x-axis) changes. What is the best description of the types of reactions shown by the green line labeled "A"? a) Catabolic, energy-consuming pathways b) Anabolic, energy-consuming pathways c) Anabolic, energy-producing pathways d) Catabolic, energy-producing pathways

Q: 3. A. Briefly discuss the four levels of structure in proteins. Knowing that the 3-dimensional shape…

A: Protein is a polypeptide made up of amino acids. The sequence of amino acids determines the…

Q: Calculate the more fraction of HC! hydrochloric water containing 30% HCl and water in a folution…

A: Mole fraction is a fraction of the number of moles of a particular component in a mixture divided by…

Q: A Moving to anothe estion 18 Articular cartilage has little to no self-healing ability. It is…

A: It is also called as hyaline cartilage. It is firm but slightly elastic or flexible cartilage of…

Q: Cow's milk allergy (CMA) and lactose intolerance both result from dietary exposure to cow's milk and…

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Q: Using the tree structures for the following monosaccharides and comparing to that for glucose, draw…

A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…

Q: TRUE OR FALSE 1. Rotational entropy is the freedom to move in three-dimensions. 2. Vitamin B1…

A: In the cellular environment, the condition do not allow biochemical reactions to occur at…

Q: The key regulatory enzymes in glycolysis are: A) hexokinase, phosphofructokinase, and pyruvate…

A: In the anaerobic process of glycolysis, one glucose molecule is transformed into two pyruvate…

Q: Which energy system did you use for a vertical one-clap pushup or pushup? (Choose one) A) ATP-PC…

A: Answer ATP-PC system Explanation The ATP-PC system, also known as the phosphagen system, is the…

Q: ✓ Part B What further experiment should be carried out in order to determine the primary structure…

A: Introduction Protein is the most abundant macromolecule in our body.  Amino acids are the building…

Q: which of the following types of information is provided by a suffix?   A) numbers b) positions…

A: Prefix, root word and suffix are used to define and complete medical terminologies.  Prefix is…

Q: 1.2 Ninhydrin Test Substance 2% glycine 2% gelatin 2% albumin 1% tyrosine casein + distilled water…

A: Ninhydrin test : It is the alpha-amino groups in proteins and amino acids that are responsible for…

Q: An aminoacyl-tRNA is initially bound to the ribosome in prokaryote at the A site on the 70S subunit…

A: A small RNA molecule known as transfer RNA (tRNA) is essential for the production of proteins.…

Q: All metabolic pathways must be regulated to maintain homeostasis. The catalytic activity of an…

A: Enzymes are biocatalysts that catalyse biochemical reactions. They contain an active site where the…

Q: Question 1 For import into the nucleus, proteins require: Ran-GTP active transport Pex5 an NES…

A: The nucleus is the compartment that is generally found in the centre of a eukaryotic cell and houses…

Q: Given the lipid structure below, part A was derived from __________ while part B was derived…

A: Glycerophospholipids have a structure similar to triacylglycerides, except that they are polar. They…

Q: 2. To track the insulin purification process, the ratio of insulin to total protein is tracked…

A: To study the physical and chemical properties of insulin, it must be separated from the mixture of…

Q: Enzyme A catalyzes the reaction S → P and has a KM of 50 μM and a Vmax of 100 nM s–1. Enzyme B…

A: The MM (Michaelis Menten) equation gives us the initial rate of a single substrate enzyme catalyzed…

Q: 1. Answer the following questions: a. A substance produced from pyruvate that is a precursor in the…

A: Glucose is the simplest carbohydrate, which is utilized as the primary source of energy. The complex…

Q: For the reaction A + 2 B 3 C + D, what is the magnitude of the rate of change for [D] when [C] is…

A:

Q: 5 When your body metabolizes fat for energy, it gets 9 Cal./g, as opposed to only 4 Cal./g from…

A: Adipose tissue is a type of connective tissue which comprises fat cells, or adipocytes, which store…

Q: Which of the following has the lowest probability of cardiac event-free survival?   high CRP and…

A: Introduction LDL (low-density lipoprotein) is also known as bad cholesterol. It can cause blockage…

Q: NADH is generated at which of the following enzyme site(s) in the citric acid cycle? OA) Aconitase.…

A: Citric acid cycle is the second step in aerobic cellular respiration. This stage results in the…

Q: 9. Compartmentation in ß Oxidation Free palmitate is activated to its coenzyme A derivative…

A: Beta oxidation is the biochemical pathway by which fatty acids are broken down two carbon at a time…

Q: Draw an approximate titration curve for lysine, given that its pKa(COOH) = 2.18, its pKa(NH3*) =…

A: Amino acid has a typical structure. It has a central Carbon atom called (Cα). To it 4 groups are…

Q: Determine the amount of glucose in the unknown sample by plotting a standard curve of Absorbance at…

A: Here we are conducting an assay to determine the amount of glucose in an unknown sample. For this,…

Q: 1. 5.5µg/mL 2. 750mL 3. 29μµL 4. 1.55g 5. 0.045mg 6. 9.5mg/L 7. 850g 8. 3.5 x 10 mL 9. 4.50 x…

A: The numbers that are too large or too small are written in decimal form. This method of expressing a…

Q: What is the effect on the biosynthetic pathways if the oxidative branch of a person’s pentose…

A: The pentose phosphate pathway (PPP)  is an alternate pathway to metabolize Glucose 6-phosphate…

Q: A TCL was run with 5 subjected samples utilizing a silica plate and ethanol/chloroform in mobile…

A: TLC (thin layer chromatography) is a type of partition chromatography, in which the samples are…

Q: Compared to an uncatalyzed reaction, an enzyme-catalyzed reaction ________. A) uses less substrate…

A: Enzyme kinetics is the study of the rates of chemical processes that are catalyzed by enzymes. The…

Q: The citric acid cycle enzyme at which FADH2 is generated is: OA) isocitrate dehydrogenase. OB) B)…

A: Citric acid cyclei s the main source of adequate energy for cells and a significant part of aerobic…

Q: 1. Isoelectric focusing. A digested protein sample was applied to one end of a gel strip with an…

A: Isoelectric focusing is a technique used to separate proteins on the basis of their isoelectric…

Q: CHOOSE THE ANSWER FROM THE FOLLOWING CHOICES: Phosphodiester Bond Glycosidic Bond Ester…

A: Nucleic acid can be of 2 types: DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Nucleic acids…

Q: draw the structures of the first dipeptides made in bacterial protein synthesis reactions when the…

A: The origin sequence is of 100 to 200 base pairs where replication fork begins. Specific proteins…

Q: 1. Which of the following statement is correct? a. Lipids can only participate in the TCA cycle. b.…

A: Metabolism of biomolecules is a interrelated process. The end product of one metabolic pathway can…

Q: How many mL of 10 x stock solution would you need to make 118 mL of 1x PBS?  Report your answer to 1…

A: The equation of dilution: C1 x V1 = C2 x V2 Where, C1 is the concentration of the stock solution. C2…

Q: Explain the difference between ΔG°’ and ΔG and calculate the free energy (delta G) of hydrolysis of…

A: In chemical and especially biochemical systems (like cells), we are concerned more about the energy…

Q: Assess the role of redox electron transfer in the formation of an  electrochemical proton gradient…

A: All processes that would end up releasing energy will take place spontaneously. This energy released…

Q: A. hand-draw the chemical structures of dipalmitoyl phosphatidyl choline, DPPC (also known as…

A: Lipids are classified into charged and neutral lipids based on the presence of phosphate group.…

Q: Reabsorption of this substance involves carbonic anhydrase - inulin - bicarbonate - glucose -…

A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…

Q: TRUE OR FALSE 1. Carboxybiotin is covalently linked to an enzyme via E- amino group of a lysine…

A: An enzyme is a substance that acts as a catalyst in the living systems. It increases the rate of…

Q: Which fibrous protein is found in connective tissue and consists of 3 left-handed helices twisted…

A: Fibrous proteins are a large class of proteins which provide strength and/or flexibility to the…

Q: ~0.766+ 47425 y-0.568x46576 . . . . . X The inhibitor binds at the active site. The inhibitor binds…

A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…

Q: 6. A. List all of the ionizable functional groups that are found in insulin when in aqueous…

A: Isoelectric Point The isoelectric point (also known as the isoelectric point, pI, or IE) is the pH…

Q: Capping of eukaryotic mRNA occurs at the 5' end O occurs at the 3' end O occurs at both ends O…

A: Transcription is the process by which the genetic information stored in the DNA is copied onto a…

Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…

A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…

Q: Draw the L(leucine)-A(alanine)-E(glutamate) triple tide and calculate its isoelectric point.

A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…

Q: 3. Prostaglandins (5) are derived from the 20-carbon fatty acid arachidonic acid in a reaction…

A: In order to solve this problem , we need to draw the Lineweaver Burk plot (LB plot). LB plot has…

Q: Figure 1 shows the structure of adenine and thymine. (i) (ii) NH H adenine -H =C thymine Figure 1…

A: These are cyclic compounds that contain nitrogen. They can be: Purines: a heterocyclic organic…

Q: I. ATP Calculation A. Given that three molecules of glucose underwent full oxidation, how many of…

A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…

Q: Calculate length of tubes required for desired production rate

A: Proteins Proteins are the long chain of amino acids , they are essential for the structure,…