Question 1 For import into the nucleus, proteins require: Ran-GTP active transport Pex5 an NES Question 2 The nuclear envelope contains nuclear pore complexes (NPCs) that allow small molecules to pass but excludes macromolecules larger than 40 kDa True False
Q: Relate sugar fermentation to the biochemical tests in bacterial identification
A: Glucose can be catabolized either aerobically (in the presence of O2), in which molecular oxygen…
Q: The key regulatory enzymes in glycolysis are: A) hexokinase, phosphofructokinase, and pyruvate…
A: In the anaerobic process of glycolysis, one glucose molecule is transformed into two pyruvate…
Q: The Krebs cycle reaction shown below is catalyzed by __ enzyme and ___ pays for this reaction note…
A: The TCA cycle or Kreb cycle occurs in the mitochondrial matrix. The TCA cycle uses the acetate in…
Q: 5. Explain in quantitative terms the circumstances under which the following reaction can proceed in…
A: Positive delta G means that the reaction cannot occur spontaneously. If delta G is negative then it…
Q: I'd like you to explain to me the structure of one of your macromolecules. You should be describing…
A: Bio molecules or biological molecules that are formed in the body of living organisms. These are…
Q: Tell why the citric acid cycle is obligately aerobic.
A: Glycolysis convert one 6-carbon molecule of glucose-6-phosphate into two molecules of 3-carbon…
Q: Differentiate reducing sugars from non-reducing sugars
A: Sugars are carbohydrates or saccharides. Sugars are ketone or aldehyde derivatives of straight-chain…
Q: FRET is a widely used biophysical technique for the characterization of a wide range of biomolecular…
A: FRET is a unique method for measuring the separation between a donor-acceptor pair of chromophores.…
Q: This is a catalase-positive, coagulase-negative, gram-positive coccus isolated from a urine specimen…
A: Introduction Bacteria are prokaryotic, unicellular organisms. They belong to the kingdom Monera.…
Q: 1. Explain the biochemical formation of creatinine, urea, and uric acid. 2. State the principle of…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: The lens of the eye si the light refracting medium of the eye, and ti has no mitochondria. Glucose…
A: "Since you have posted a question with multiple sub parts, we will provide the…
Q: DNA: AGA ACA TAA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GAC…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Cow's milk allergy (CMA) and lactose intolerance both result from dietary exposure to cow's milk and…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: The concentration of protein in a solution can be determined via UV spectroscopy and colorimetry*…
A: UV spectroscopy UV spectroscopy is a technique which uses the absorption of ultraviolet radiation by…
Q: 3. Consider the molecule dopamine (shown). Given that its pKa(NH3*) = 10.9. НО. a. What pH range…
A: A buffer system is a solution that contains an acid-conjugate base pair in equal proportions or…
Q: Explain the role of carnitine in the energy supply of the myocardium
A: Carnitine plays an important in heart's metabolism. It's responsible for transporting fatty acids,…
Q: Scope of Industrial biochemistry
A: Industrial biochemistry: The practice or application of set of chemical processes that occur within…
Q: Leu 93 Val 49. Are these two residues polar or hydrophobic (nonpolar)? What effect should their…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group attached to…
Q: 3. Please draw the core structure of Lignan, and numbering the C-atoms.
A: In 1948, Haworth first introduced the term "Lignan", which are also subgroup of non-flavonoid…
Q: 1. Describe how each of the following modes of analysis may be used to measure enzyme activity:…
A: Since you have posted multiple questions with multiple sub parts, we will provide the solution only…
Q: 1. Why is it necessary to calibrate a Pasteur pipette? 2. Cite some possible sources of errors in…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: For Gal(Beta 1 - 4)Glc, Explain in detail the glycoside bond: What carbon involved in glycoside…
A: The Structure of Gal(Beta 1-4)Glc is given below. 'Gal' stands for galactose and 'Glc' stands for…
Q: Choose the correct path taken by a pair of electrons as they travel down the electron-transport…
A: Electron transport chain consists of a group of protein complexes in the mitochondrial membrane…
Q: A. Dissolution of drugs Tablets Aspirin Bisacodyl Generalizations: Vinegar Solution pH: 2.5 5…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: I am confused what is HDI. pls define in easy words.
A: Lipoproteins are triacylglycerols, phospholipids, cholesterol, and cholesterol esters associated…
Q: show how you would use bromination followed by amination to synthesize glycine show how you would…
A: Amino acids are building blocks of proteins. Alpha carbon of amino acids consist of carboxyl group,…
Q: True or false 1. Heterogenous antibodies used for structural studies can be obtained by monoclonal…
A: Heterogenous antibodies - Heterogenous terms indicates that the molecule is a hybrid. i.e. a single…
Q: Choose below the order of plasma lipoproteins based on the particle size (from smallest to largest):…
A: Lipoproteins are particles made of protein and lipids. They are responsible for carrying cholesterol…
Q: RUE OR FALSE 1. Abzymes reduce rotational entropy. 2. Hammerhead ribozymes have the ability to bind…
A: Enzymes are catalysts acting inside the living system to reduce the reaction time and speed up the…
Q: The processes that are involved in protein degradation and folding release energy in the form of ATP…
A: Protein degradation is the process in which proteins are hydrolysed and broken down into individual…
Q: 1. If the hydrophobic solvent hexane (C6H14) was the "solvent of life", predict the following and…
A: The structure of biological macromolecules is determined by noncovalent interactions like…
Q: Describe method by which uncoupling agents (like 2,4-dinitrophenol) inhibit oxidative…
A: The oxidation of carbohydrates such as glucose generates electrons that are carried to the electron…
Q: How DMT affects the brain?
A: Introduction Neurotransmitters are a type of chemical messengers that transmit chemical signals…
Q: what are the features which set the G protein family of receptors apart?
A: G protein-coupled receptors (GPCRs) are regarded as one of the most extensive families of validated…
Q: Is B monomer a beta fructose or alpha fructose. How do you know？
A: Cyclization of linear fructose can give us a furanose ring. Furanose is 5 membered ring . The 5…
Q: The folding of an unfolded protein proceeds from low entropy disordered state to a single high…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Why could the acrolein test be used as a general test for all fats?
A: The qualitative analysis of lipids assists us in determining the presence or absence of lipids based…
Q: How is osmosis different from simple diffusion? Oosmosis involves the movement of water, simple…
A: The two forms of passive transport that are essential for transporting molecules into and out of the…
Q: A. Given the following piece of messenger RNA (mRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAG…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: 1. Which of the following statement is correct? a. Lipids can only participate in the TCA cycle. b.…
A: Metabolism of biomolecules is a interrelated process. The end product of one metabolic pathway can…
Q: I. ATP Calculation A. Given that three molecules of glucose underwent full oxidation, how many of…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: 2. The amino acid side chain residues in an a helix point center of the helix. A) Outward B) Inward…
A: Proteins have four level of structures. Primary structure Secondary Structure Tertiary Structure…
Q: Draw the L(leucine)-A(alanine)-E(glutamate) triple tide and calculate its isoelectric point.
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: In protein structure, which is not established via secondary interactions? o tertiary o secondary o…
A: Proteins are polymers of amino acids linked by peptide/amide bond with release of one water molecule…
Q: 23. Which is a general term indicating a carbohydrate polymer? A) Glycan B) Polycarb C) Multimer D)…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: These enzymes form covalent intermediates A. Papain B. Alkaline phosphatase C. Elastase D. All of…
A: Enzymes are biological catalysts that increases the rate of the reaction. They do so by having a…
Q: Uracil and Adenine are two nitrogen bases constitutive of RNA. Both compounds show maximum…
A: The Beer Lamberts equation relates the absorbance value given by an analyte for a particular…
Q: b) How does oxygen availability determine the fate of the glycolysis pathway?
A: Glycolysis is a central metabolic pathway that is used by all cells for the oxidation of glucose for…
Q: How much 6x loading dye should be added to 49 uL of DNA? Report you answer in units of uL, with one…
A: The equation of dilution: M1xV1 = M2xV2 Where, M1 is the molar concentration of the stock solution.…
Q: Use dAMP and dTMP to draw the two monomers together
A: Nucleotides are structural components of nucleic acids (DNA or RNA). Nucleotides are composed of a…
Step by step
Solved in 3 steps
- QUESTION 15 Which of the following molecules is NOT a component of desmosomes? A Intermediate filaments B Actin C Plakoglobin D Desmoplakin E DesmocolinQuestion 16: One of the two genes known to be mutated in cases of Hypokalemic periodic paralysis (which is inherited in an autosomal dominant pattern but known to affect males more often than females) is the calcium voltage-gated channel subunit alpha1 S (CACNA1S). What is known about the gene is recorded here: https://www.ensembl.org/Homo_sapiens/Gene/Summary?db=core;g=ENSG00000081248;r=1:201039512-201112451 Please navigate to the link above and use the information and link-outs from the page to answer the following question. GIVE YOUR ANSWER AS A NUMBER ONLY, NO UNITS: What is the size in amino acid residues of the CACNA1S transcript named CACNA1S-202?QUESTION 20 You are studying the effects of removing integrins from cells. Which of the following abilities is the cell most likely to lose? A The cells are going to lose their ability to make connections with the ECM. B The cells will lose their ability to secrete growth factors. C The cells are going to lose their ability to form cell-cell adhesions. D The cells are going to lose their ability to communicate with the cytoskeleton.
- Question 12 One of the two genes known to be mutated in cases of Hypokalemic periodic paralysis (which is inherited in an autosomal dominant pattern but known to affect males more often than females) is the calcium voltage-gated channel subunit alpha1 S (CACNA1S). What is known about the gene is recorded here: https://www.ensembl.org/Homo_sapiens/Gene/Summary?db=core;g=ENSG00000081248;r=1:201039512-201112451 Please navigate to the link above and ensure that you click to reveal the transcript table. Then use the information in the table to answer the following question. PLEASE GIVE YOUR ANSWER AS A NUMBER ONLY, NO UNITS What is the size in base pairs of the CACNA1S transcript named CACNA1S-202? Answer: The size of the CACNA1S transcript named CACNA1S-202 is Blank ... base pairs.Question 13 One of the two genes known to be mutated in cases of Hypokalemic periodic paralysis (which is inherited in an autosomal dominant pattern but known to affect males more often than females) is the calcium voltage-gated channel subunit alpha1 S (CACNA1S). What is known about the gene is recorded here: https://www.ensembl.org/Homo_sapiens/Gene/Summary?db=core;g=ENSG00000081248;r=1:201039512-201112451 Please navigate to the link above and use the information and link-outs from the page to answer the following question. GIVE YOUR ANSWER AS A NUMBER ONLY, NO UNITS: What is the size in amino acid residues of the CACNA1S transcript named CACNA1S-202? Answer: The size of the CACNA1S transcript named CACNA1S-202 is Blank ... amino acid residues.Question 14 One of the two genes known to be mutated in cases of Hypokalemic periodic paralysis (which is inherited in an autosomal dominant pattern but known to affect males more often than females) is the calcium voltage-gated channel subunit alpha1 S (CACNA1S). What is known about the gene is recorded here: https://www.ensembl.org/Homo_sapiens/Gene/Summary?db=core;g=ENSG00000081248;r=1:201039512-201112451 Please navigate to the link above. Use the left-hand menu to view the sequence for CACNA1S, and answer the following question. ANSWER ONLY IN UPPERCASE LETTERS, NO UNITS. What are the last six nucleic acid bases of exon 1? Answer: The last six nucleic acid bases of CACNA1S, exon 1 are Blank ...
- QUESTION 32 All living organisms, including both bacteria and Eukaryotes have: (Select all that apply) the ability to extract energy from the environment to do work Ribosomes double stranded DNA L-amino acids Peptidoglycan Nuclei D-monosaccharides Plasma membranes made of phospholipids Robust cytoskeleton, including actin and microtubulesQuestion 24 pts When we are vaccinated against SARS-CoV-2, what happens? (select all correct answers) Group of answer choices a) Our adaptive immune system becomes primed to recognize the SARS-CoV-2 virus. b) Our DNA becomes modified. c) We will permanently have viral proteins in our cells d) Our cells will make a partial or complete viral protein, which our immune system will recognize as foreign. e) Memory cells will be ready for a new infection.QUESTION NO. 1Statements: (1) Glucose is both a hexose and a aldose. (2) There can never be more than three enantiomers for a molecule. (3) All common disaccharides have beta-one-four linkages. Which statements are true?QUESTION NO.2 Erythrocyte glucose transporter illustrates the type of A. ion driven active transport B. facilitated diffusion C. active transport D. simple diffusion E. secondary active transportQUESTION NO.3 which of the following statement/s accurately describe the surface of a lipid droplet? A. a monolayer of phospholipids B. a bilayer of phospholipid C. a network of perilipin protein D. a structured layer of triacylglycerol E. a chaotic hydrophobic/ hydrophilic interface
- QUESTION NO. 1 Cystic fibrosis is a frequent generic disease of Caucasians. The CF gene codes for a protein called the cystic fibrosis transmembrane conductance regulator (CFTR) which functions as a cAMP-regulated chloride channel. The protein has two membrane-spanning domains, two domains that interact with ATP, and one regulatory domain. The most common defect is in the gene for one of the ATP binding domains. The result is a protein that does not fold correctly in the endoplasmic reticulum, is not properly glycosylated, and is nor transported to the cell surface. Rather, it is degraded in the cytosol within proteasomes. Drugs that foster chaperone interaction with the mutant protein are a potential therapeutic approach. Chaperones A. are always required to direct the folding of proteins. B. when bound to protein increase the rate of protein degradation. C. usually bind to strongly hydrophilic regions of unfolded proteins. D. sometimes maintain proteins in an…QUESTION 5You are asked to recommend an antibiotic to treat potential pathogenicityt in an animal. Describe a method which will allow you to make this recommendation.QUESTION 16 Match the definitions and key words with the group name (programmed or stochastic). From the drop down boxes, choose the correct letter (A -- Programmed or B -- Stochastic). Celluar Aging: suggesting that the lifespan of a species is determined by an internal cellular "clock" that limits the number of cell divisions. Immune System: suggesting that aging is due to a break-down in the body's natural defense system against bacteria, viruses, and other substances. Error Theory: suggesting that errors at the cellular level produce "faulty" molecules. Evolutionary theory: suggesting that aging is a natural way to limit the reproductive potential and timespan of members of a species. Wear and Tear: suggesting that like a battery or a machine, the human…
