the following correctly describes a possible scenario dunng a run of gel electrophoresis wit DNA samples? Because DNA molecules are positively-charged due to the phosphate groups in their backbone, DNA fragements will migrate from the anode to the cathode. Because DNA molecules are negatively-charged due to the phosphate groups in their backbone, DNA fragments will migrate from the anode to the cathode. Shorter fragments of DNA are lighter. Hence, they move faster through the gel and travel the farthest from the wells.

the following correctly describes a possible scenario dunng a run of gel electrophoresis wit DNA samples? Because DNA molecules are positively-charged due to the phosphate groups in their backbone, DNA fragements will migrate from the anode to the cathode. Because DNA molecules are negatively-charged due to the phosphate groups in their backbone, DNA fragments will migrate from the anode to the cathode. Shorter fragments of DNA are lighter. Hence, they move faster through the gel and travel the farthest from the wells.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 6QP: Which of the following best describes the process of DNA sequencing? a. DNA is separated on a gel,...

See similar textbooks

Similar questions

Which of the following is true of the gel electrophoresis shown? A) the power source has not been turned on yet. B) the three wells contained the same DNA molecules. C) well #1 had fewer molecules of DNA than well #2 or #3 D) well #3 had more different sized molecules of DNA than well #1 or #2 Which of the following statements is TRUE about the band of molecules labeled X ( close to where it says positive electrode). A) it contains DNA fragments that are shorter than the ones in any of the other bands. B) it contains fewer DNA molecules than any of the other bands from lane 3. C) it contains more negatively charged particles than any other band on the gel. D) it contains fewer genes than any of the other bands on the gel.
Which of the following best describes the process of DNA seqencing. a. DNA is seperated on a gel and the different bands are labled with flouroscent nucleotides and scanned with a laser. b. A laser is used to flurorescently label the nucleotides present with in the DNA , the DNA is run on a gel and then the DNA is droken into fragments c. Nucleotides are scanned with a laser and incrprorated into the DNA that has been seperated on a gel and then DNA is amplified with PCR. d. fragments of DNA are produced in a reaction that lables them with any of four different fluroscent dyes and the fragmented then are run on a gel and scanned with laser e. DNA is broken down into its constituents nucleotides and the nucleotides are then run on a gel and purified with a laser
Visually compare the intensity of your team’s Plant-DNA sample with the intensity of the 3 kb band on the DNA ladder (see figure posted below). For example, if your Plant- DNA sample closely matches the 3 Kb band, this represents approximately 125 ng of total DNA. Divide the approximate mass (ng) of DNA in your sample by the volume loaded in the gel minus the loading dye added (i.e., 12 – 2 = 10 μL, since you loaded 12 μL from a 24 μL sample that contained 20 μL DNA prep + 4 μL loading dye. What is the DNA concentration of your sample? ______ng/μL
Which of the following is TRUE with respect to electrophoresis? a. DNA is not attracted to either pole but in fact moves by diffusion through the TAE buffer in the agarose. b. DNA can be attracted to either pole depending on the bases it is made of. c. DNA is attracted to the negative pole. d. DNA is attracted to the postive pole
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
Why is it important that the alcohol used in the DNA extraction is kept cold? The solubility of any compound is reduced at lower temperatures. The colder the temperature of the alcohol, the greater the yield of DNA due to increased precipitation of DNA at the interface between the aqueous and alcohol layers. The solubility of any compound is increased at lower temperatures. The colder the temperature of the alcohol, the greater the yield of DNA due to increased solubility of DNA at the interface between the aqueous and alcohol layers. The solubility of any compound is reduced at lower temperatures. The colder the temperature of the alcohol, the greater the yield of DNA due to increased precipitation of DNA in the aqueous layer. The solubility of any compound is increased at lower temperatures. The colder the temperature of the alcohol, the greater the yield of DNA due to increased solubility of DNA in the aqueous layer.
In DNA isolation techniques, a washing step is always done prior to the final resuspension. What is the purpose of this step? In DNA isolation from blood samples, why does the vial for blood storage contain EDTA? In the preparation for DNA isolation in plants, the plant source is refrigerated and ground prior to extraction. Why is this so? Why are DNA pellets air-dried before resuspension in buffer?
What is the role of alcohol in extracting DNA? DNA is a polar molecule with an overall negative charge, and as such is not soluble in alcohol, and therefore precipitates. DNA is a polar molecule with an overall positive charge, and as such is not soluble in alcohol, and therefore precipitates. DNA is a non polar molecule with an overall negative change, and as such is soluble in alcohol, and therefore precipitates. DNA is a polar molecule with an overall positive change, and as such is soluble in alcohol, and therefore precipitates.
What causes the DNA to migrate from the wells toward the positive electrode? a) DNA is positively charged too, and so was attracted to the positive electrode b) DNA is negatively charged, and so was attracted to the positive electrode c) DNA is polar and forms hydrogen bonds with the positive electrodes d) DNA is electrically charged, and so cycles through an electric field The ratio of absorption at 260nm to absorption at 280nm is commonly used to assess. (Note: purity of DNA should be the right answer, but a is shown as wrong) a) The concentration of DNA and RNA. b) The purity of protein. c) Whether your DNA or RNA is contaminated Trizol. d) The concentration of protein in your sample. How many different bases are associated with RNA? a) 5 b) 4 c) 3 d) 6
Which of the following statements about gel electrophoresis is false? Choose all the answers that would apply -Smaller DNA fragments travel faster and further during gel electrophoresis. -DNA fragments can be separated based on fragment length. -DNA fragments can be separated based on DNA sequence. -Larger DNA fragments travel faster and further during gel electrophoresis.
Which of the following is true about the denaturation of double-helical DNA? A. Denaturation increases with decreasing temperature. B. Denaturation is accompanied by an increase in the absorption of UV light by DNA. C. G-C rich DNA melts at lower temperature than A-T rich DNA. D. Once denatured, DNA strands cannot anneal.
The following DNA fragment was sequenced by the Sanger method. The red asterisk indicates a fluorescent label. A sample of the DNA was reacted with DNA polymerase and each of the nucleotide mixtures (in an appropriate buffer) listed below. Dideoxynucleotides (ddNTPs) were addedin relatively small amounts.1. dATP, dTTP, dCTP, dGTP, ddTTP2. dATP, dTTP, dCTP, dGTP, ddGTP3. dATP, dCTP, dGTP, ddTTP4. dATP, dTTP, dCTP, dGTPThe resulting DNA was separated by electrophoresis on an agarose gel, and the fluorescent bands on the gel were located. The band pattern resulting from nucleotide mixture 1 is shown below. Assuming that all mixtures were run on the same gel, what did the remaining lanes of the gel look like?