The following non-coding sequence (i.e. template strand) is transcribed by the RNA pol II into a pre-mRNA. 5'-CTAACTGCTATGCAT-3' a) Determine the mRNA synthesized by the RNA pol II. You have to write the sequence from the 5' end to the 3' end and indicate those ends as shown in the original sequence. b) Using the genetic code provided below, determine the amino acid sequence if the mRNA determined in part a) were translated. You have to write the amino acid sequence from the N-terminus end to the C-terminus end and indicate those at each and in parentheses. For example: (N)-.......-(C) A mutation occurred in the nucleotide sequence, and the new non-coding sequence is shown below: 5'-CTAACTGCTAGTGCAT-3' c) Indicate the specific mutation that occurred in the non-coding strand and its type. d) What consequence will the mutation have on the polypeptide chain? Justify your answer and write the new polypeptide sequence if it has changed as a result of this mutation. You have to write the amino acid sequence from the N-terminus end to the C-terminus end and indicate those at each and in parentheses. For example: (N)-.......-(C)

The following non-coding sequence (i.e. template strand) is transcribed by the RNA pol II into a pre-mRNA. 5'-CTAACTGCTATGCAT-3' a) Determine the mRNA synthesized by the RNA pol II. You have to write the sequence from the 5' end to the 3' end and indicate those ends as shown in the original sequence. b) Using the genetic code provided below, determine the amino acid sequence if the mRNA determined in part a) were translated. You have to write the amino acid sequence from the N-terminus end to the C-terminus end and indicate those at each and in parentheses. For example: (N)-.......-(C) A mutation occurred in the nucleotide sequence, and the new non-coding sequence is shown below: 5'-CTAACTGCTAGTGCAT-3' c) Indicate the specific mutation that occurred in the non-coding strand and its type. d) What consequence will the mutation have on the polypeptide chain? Justify your answer and write the new polypeptide sequence if it has changed as a result of this mutation. You have to write the amino acid sequence from the N-terminus end to the C-terminus end and indicate those at each and in parentheses. For example: (N)-.......-(C)

Name: Please answer all parts of the question First base in codonThe followi
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Please answer all parts of the question First base in codonThe following non-coding sequence (i.e. template strand) is transcribed by the RNA pol II intoa pre-mRNA.5'-CTAACTGCTATGCAT-3'a) Determine the mRNA synthesized by the RNA pol II.You have to w

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
The following represent deoxyribonucleotidesequences in the template strand of DNA:Sequence 1: 5'@CTTTTTTGCCAT@3'Sequence 2: 5'@ACATCAATAACT@3'Sequence 3: 5'@TACAAGGGTTCT@3'(a) For each strand, determine the mRNA sequencethat would be derived from transcription.(b) determine the amino acidsequence that is encoded by these mRNAs.(c) For Sequence 1, what is the sequence of the codingDNA strand?
The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the use of UAUC incorporates four amino acids. Why?
The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a diff erent C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.
From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' Using ONE-letter amino acid code starting from N-terminus to C-terminus, what is the amino acid sequence that will be coded for?
From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using THREE-letter amino acid code starting from N-terminus to C-terminus.
From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using ONE-letter amino acid code starting from N-terminus to C-terminus and using THREE-letter amino acid code starting from N-terminus to C-terminus
What is the total size of the mature i.e. fully processed mRNA in nucleotides? How many amino acids would the encoded protein be? Assume that the N- terminal Met encoded by the AUG start codon, is NOT cleaved from the protein?
Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.