The following strand is a template strand: 3'-АТСТАСССТТCGACTAGAАСААСТ-5' The non-template strand is 5'- -3'. Hint: no spaces or commas, just give the sequence. The mRNA sequence the template strand codes for is 5'- -3'.

The following strand is a template strand: 3'-АТСТАСССТТCGACTAGAАСААСТ-5' The non-template strand is 5'- -3'. Hint: no spaces or commas, just give the sequence. The mRNA sequence the template strand codes for is 5'- -3'.

Name: The following strand is a template strand:3-АТСТАСССТТCGACTAGAАСААСТ-
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The following strand is a template strand:3-АТСТАСССТТCGACTAGAАСААСТ-5'The non-template strand is 5'--3'. Hint: no spaces or commas, just givethe sequence.The mRNA sequence the template strand codes for is 5'--3'.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Portions of eukaryotic mRNA sequence that are removed during RNA processing are . a. exons b. caps c. poly-A tails d. introns
The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNA
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
_______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acids
A certain template DNA strand has the following nucleotide sequence: 3'—TACTGCATAATGATT—5' What would be the sequence of codons in the mRNA transcribed from this strand? What would be the nucleotide sequence of the complementary nontemplate DNA strand?
A strand of DNA, TACGCT, serves as a template for mRNA transcription. What would be the correct sequence of mRNA transcribed from this DNA template? ATGCGA UACGCU AUGCGA TACGCT
The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this gene code for? The top is the coding strand. 5' GGCTATGTATAGGGTAAACTTCTGACGCCTA 3' 3’ CCGATACATATCCCATTTGAAGACTGCGGAT 5’
What will be the sequence of mRNA produced by the following stretch of DNA? 3' ATCGGTTAAC 5' TEMPLATE STRAND 5' TAGCCAATTG 3' CODING STRAND 1. 5' AUCGGUUAAC 3' 2. 3' GUUAAGGCAU 5' 3. 3' GUUAACCGAU 5’ 4. 5' UAGCCUUAAC 3'
A DNA antisense strand contains the following nucleotide base sequence:CGA TTT GGT TGAFrom this, what is the nucleotide sequence of the mRNA strand that is transcribed? a. CGA UUU GGU UGA b. GCU AAA CCA ACU c. GCA AAA CCA ACT d. CGA TTT CCA ACT
A DNA strand with the sequence 3’ AACGTAACG 5’ is transcribed. What is the sequence of the mRNA molecule? 5’ AACGTAACG 3’ 5’ UUGCAUUGC 3’ 5’ TTGCATTGC 3’ 5’ UUGCAUUGC 3’