A DNA antisense strand contains the following nucleotide base sequence: CGA TTT GGT TGA From this, what is the nucleotide sequence of the mRNA strand that is transcribed? a. CGA UUU GGU UGA b. GCU AAA CCA ACU c. GCA AAA CCA ACT d. CGA TTT CCA ACT

A DNA antisense strand contains the following nucleotide base sequence: CGA TTT GGT TGA From this, what is the nucleotide sequence of the mRNA strand that is transcribed? a. CGA UUU GGU UGA b. GCU AAA CCA ACU c. GCA AAA CCA ACT d. CGA TTT CCA ACT

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 7RQ: Portions of eukaryotic mRNA sequence that are removed during RNA processing are . a. exons b. caps...

See similar textbooks

Related questions

Q: Translation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: During DNA replication, as DNA unwinds it can become supercoiled causing twists that stress the…

A: DNA (deoxyribonucleic acid) is a double-stranded molecule in which the two strands wind around each…

Q: During transcription the strands of DNA unwind due to the action of

A: Transcription and replication are processes that need access to DNA. DNA is usually tightly coiled…

Q: The function of the genetic code is toa. promote transcription.b. specify the amino acids within a…

A: Genetics can be defined as the branch of biology which is concerned with the study of genes, genetic…

Q: . List the sequences of RNA that would be transcribed template sequences. a. Ans:…

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…

Q: Reverse transcriptase assembles a(n)_____ on a(n)_____ template. a. mRNA; DNA c. DNA; ribosome b.…

A: DNA (Deoxyribonucleic acid) is the hereditary material present in most of the living organisms ,…

Q: transcribed RNA

A: Transcription is the process of copying a segment of DNA into RNA. Only one of the two DNA strands…

Q: The technique of DNA sequencing involves performing _______________ . A) northern blotting B)…

A: DNA sequence can be determined by performing DNA sequencing method in vitro.

Q: Examine the following sequence of DNA 3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG –…

A: The central dogma is a metabolic process where the DNA acts as genetic material and transcripted…

Q: The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA…

A: The RNA sequence would be same as coding strand (except thiamine is replaced by uracil) and opposite…

Q: Complete the following table and answer the next two questions. DNA____________ strand T…

A: The process of synthesis of RNA with the help of complementary strand of DNA is called…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: a) One DNA strand of Chromosome #12 has the following nucleotide sequence: TAC/CGC/CCT. What…

A: DNA is a double stranded helical structure present inside the nucleus. It acts as a hereditary…

Q: A nucleotide sequence in a segment of a DNA information strand is given here. Sketch (A) the…

Q: Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the…

A: Gene expression is the process by which the instructions in the DNA are converted to functional…

Q: Some events that take place in proteins synthesis are shown below: A. An enzyme reads the gene…

A: TRANSCRIPTION It is the process of transfer of sequence information from DNA to RNA . The DNA…

Q: DNA polymerase can only add nucleotides to an existing chain, so _______ is required.a. a primer b.…

A: Genetics is a part of science worried about the investigation of genes, genetic variety, and…

Q: The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome:…

Q: A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Give

A: Introduction:- The central dogma of biological sciences explains how genetic information is…

Q: Complete the table below: DNA DNA Complimentary Strand mRNA sequence tRNA sequence Amino…

A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…

Q: Suppose that section x, y, and z of the following hypothetical DNA strand are the exon (coding…

A: Exons and introns are nucleotide sequences within a gene. Exons are the coding sections of a gene…

Q: The sequence of mRNA made using the DNA double helix shown below is (Select ] The sequence of…

A: Introduction Protein synthesis is a two step process. In the first step, a molecule of mRNA is…

Q: Shown is a representation of a DNA molecule being transcribed.(a) Identify every 3′ end and every 5′…

A: Transcription is the process in which the codes in DNA are transcribed to mRNA. This helps to…

Q: D. Fill in the table below. Determine the correct template and coding strands to properly answer…

A: DNA is a double helical macromolecule that has genes that contain the necessary information for the…

Q: Which type of cells were used to extract the DNA that was sequenced? a. red blood cells c. white…

A: 1) Extraction of DNA is a very lengthy process; it can be extracted from any cell, either…

Q: a. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and…

A: The given DNA, 5'- ATGTCGACGCGCAGGTGA - 3' 3' - TACAGCTGCGCGTCCACT - 5'

Q: Consider the following segment of a template strand of DNA: Part A -АТА AGC TTC GAC What is the MRNA…

A: Transcription is the process of making an RNA copy of a gene sequence known as mRNA by using DNA as…

Q: PART C. Use your codon chart to determine the amino acid sequence. Remember to read through the…

A: the three-letter genetic code is the way by which the cell transcript the information from DNA to…

Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…

A: DNA is a double stranded helical structure present inside the nucleus. It acts as a hereditary…

Q: Bēlöw is thế TEMPLATE strand of DNA for a particular gene. Template strand: 5' AATCАTAAСТСАТTG 3' A.…

A: The two types of strands in DNA are coding (non-template) and template (non-coding). Both strands…

Q: . Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the…

A: “Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts…

Q: 2. DNA → AGA ACA TAA ATG CTC TTA ACA CTC ATC AGA CCA GCA CTC CGA TGA MRNA > tRNA → protein >

A: During transcription, the DNA of a gene serves as a template for complementary base-pairing, and an…

Q: ake this strand of DNA and a) Transcribe it, then b) Translate it. TAC GCA GTA ACA GGC CCT ATC a)…

Q: Given the following non-coding strand of DNA nucleotides:G T T C C C T T T G G A A C C T G G Write…

A: Nucleic acids are the essential macro molecules that carry and transmit genetic information in the…

Q: b. Now do this AGAIN assuming that the DNA and RNA templates are read right to left. DNA strand DNA…

A: The mRNA is produced from the DNA template by the transcription process and then mRNA is used for…

Q: If the code for an amino acid is ATG on the DNA molecules, this code on the transfer RNA molecule…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: DNA…

Q: Following transcription, the RNA has a complementary sequence of which of the following? Question 9…

A: The process of copying of DNA segment onto an RNA using enzymes and nucleotides is called as…

Q: radiodurans can survive strong ionizing radiation (gamma radiation). What DNA repair process? a.…

A: Gamma radiation break DNA strand and create oxidative DNA damage. To repair this need homologous…

Q: During translation

A: The translation involves the synthesizing proteins through ribosomes in the cytoplasm or endoplasmic…

Q: During DNA replication, the helicase enzyme binds to DNA and Select one: a. prevents the DNA strands…

A: DNA is the nucleic acid that is present in the nucleus of eukaryotic cells and in the nucleoid…

Q: . Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…

A: The central dogma of life involves three processes. They are: Replication: - In this process,…

Q: 5’-GGC TAC GTA ACT TGA TAA-3’ (a) mRNA codons that are transcribed from the DNA (b) tRNA…

A: “Since you have posted a question with multiple sub-parts, we will solve the first three subparts…

Q: . To attach to viral sequences b. To weigh down mRNA c. To terminate translation…

A: The purpose of a Poly-A tail being added to mRNA is to terminate translation. The polyA tail is a…

Q: Which of the following statements describe reversal of DNA repair mechanism. A. UV light blocks the…

A: Solution : correct option is C

Q: Given the following DNA strand: TACAGAGATAACCGAATT A. Write the corresponding strand that would…

A: Introduction Deoxyribonucleic acid, or DNA, is a molecule that holds the instructions that allow an…

Q: Transcribe the corresponding mRNA strand from the given DNA strand: DNA: TAC GCA…

A: BASIC INFORMATION DNA It stands for deoxyribo nucleic acid. It is the genetic material of all…

Q: For each example: a. fill in the complimentary DNA strand b. fill in the correct mRNA bases by…

A: Genetic code is the information stored in DNA in the form of its nucleotide sequence.

Q: Given the following DNA strand: TACAGTGATAACCAGATT A. Write the corresponding strand that would form…

A: A) the corresponding strand that would form the other half of the DNA molecule is ATGTCACTATTGGTCTAA…

Concept explainers

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.

Question

A DNA antisense strand contains the following nucleotide base sequence:

CGA TTT GGT TGA

From this, what is the nucleotide sequence of the mRNA strand that is transcribed?

CGA UUU GGU UGA

GCU AAA CCA ACU

GCA AAA CCA ACT

CGA TTT CCA ACT

Definition Definition A complex molecule that makes up a fundamental unit of a DNA or RNA molecule. Nucleotides are composed of a sugar, a nitrogenous base, and a phosphoric acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Follow-up Questions

Read through expert solutions to related follow-up questions below.

Follow-up Question

A DNA antisense strand contains the following nucleotide base sequence:
AGT GTC TTT GAC
From this, what is the nucleotide sequence of the mRNA strand that is transcribed?
a. AGU GUC UUU GAC
b.
UCU CUG UUU CAG
UCA CAG AAA CUG
d. TCA CAG AAA CTG
C.
How many amino acids does the mRNA strand above code for? .

Solution

by Bartleby Expert

SEE SOLUTION

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.
Portions of eukaryotic mRNA sequence that are removed during RNA processing are . a. exons b. caps c. poly-A tails d. introns
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'
The following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?
If a sequence of mRNA is CUG AGU GCA, which of the following is the DNA segment from which it was transcribed? \ a. GAC TCA CGT b. GAG TAC GCC c. CGC ATG CGG d. GAC UCA CGU
if the DNA sequence if: TTACGTA, the complementary RNA sequence will be following A. AATCGAT B. AATGCTA C.AATGCAT D.AAUGCAU
Translation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence TTCGACCCT B) an mRNA strand with the sequence TTCGACCCT C) a sequence of three amino acids linked by peptide bonds D) an mRNA strand with the sequence UUGCACCCU
If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the corresponding gene is... which of the following answers? a. CTCAAGTGTCATCCG b. GCCTACTGTGAACTC c. 3' GAGTTCACAGTAGGC 5' d. GAGTTCACAGTAGGC e. none of the above
(a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg).As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts…
a) One DNA strand of Chromosome #12 has the following nucleotide sequence: TAC/CGC/CCT. What nitrogenous bases would be found on "the other DNA strand lying alongside of it?" b) Which nitrogenous bases would be found on the MRNA (Messenger RNA) transcribed from a DNA strand with the following nucleotide sequence: AAA/TTT/GGG/CCC?
The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA is: A) 5’UCCUACGUGCAUG3’ B) 5'AGGATGCACGTAC 3’ C) 3’UCCUACGUGCAUG5’ D) 3’AGGAUGCACGUAC5’ E) 5’AGGAUGCACGUAC3’