the function of the small ribosomalsubunits isO make tRNA templatejoin amino acids to form a polypeptidechainO read the RNAThe combination between two haploidcells(male and female gametes) duringthe fertilization process, will create a:Cell with one copy of each chromosome,called zygoteCell with two copies of eachchromosome, called zygoteTwo cells with one copy of eachchromosome, called zygote

Answered: Image /qna-images/answer/16ce0100-afa6-499a-bea6-5f41c3676a8a.jpg

Answered: the function of the small ribosomal…

Science

Biology

the function of the small ribosomal subunits is

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 6P

See similar textbooks

Related questions

Q: TRNA has peptidal transferase activity. True False Genetic information stored in mRNA is translated…

A: A ribosome is a biological unit made up of Protein molecules and RNA that functions as the cell's…

Q: How is tRNA involved in protein synthesis? How genetic code helps

A: Transfer ribonucleic acid (tRNA) is a type of RNA molecule that helps decode a messenger RNA (mRNA)…

Q: Describe the structure of IgG in detail by referring to the different levels of protein structure

A: Antibodies are glycoprotein, which has antigen-binding site, each amino acid has different amino…

Q: Explain the subunits of ribosomal RNA

A: Ribosomal ribonucleic acid or rRNA is a kind of non coding DNA which is major component of ribosome…

Q: Describe the structure and function of tRNA

A: BASIC INFORMATION RNA It stands for Ribonucleic acid. They are of three types; messenger RNA…

Q: Each ribosomal subunit is composed of a. multiple proteins. c. tRNA. b. rRNA. d. both a and b.

A: The rRNA or ribosomal RNA is involved in translation. The ribosomal protein along with the rRNA make…

Q: What evidence supports the view that ribosomal RNAs are a more important component of the ribosome…

A: The discovery of ribozymes was the first indication of rRNA's importance (catalyze peptide- bond…

Q: Translation is the process by which ribosomes synthesize_______?

A: The genes present on the template strand of the DNA are transcribed into mRNA. mRNA is translated to…

Q: Introns in mRNA bind to tRNA at the ribosome

A: True.

Q: What is Exons C

A: Exons are nucleotide sequences in DNA and RNA that are conserved in the creation of mature RNA.…

Q: The E site on the ribosome is

A: Translation is the process of formation of a sequence of amino acids using messenger RNA as a…

Q: the sequences od tRNA and corresponding mRNA is complementary to each other. is the statement true…

A: The synthesis of a functional protein involves two processes namely transcription and translation.…

Q: RNA has many functions in a cell. Besides mRNA, which carries information from the genome to the…

A: RNA is a nucleic acid which is present in all living cells. It has structural similarities to DNA…

Q: Amino acids Codon MRNA Ribosome TRNA

A: Introduction : Translation is an important process of the central dogma. The DNA or deoxyribonucleic…

Q: What are the two major molecules that make up ribosomal subunits? Recalling information from chapter…

A: Ribosomes are macromolecules found in abundant quantities in the cells of living cells. An actively…

Q: These all relate to the translation of genetic informationstored in mRNA into proteins and how…

A: The highly diverse form of protein structure present in all cells are known as Ribosomes. In…

Q: Explain the structure of tRNA?

A: Ribonucleic acid (RNA) is a type of nucleic acid, which is used in key metabolic processes for all…

Q: Describe the structural features that all tRNA molecules have in common.

A: Introduction tRNA is also referred as Transfer RNA which has a 3D structure like clover leaf. It…

Q: Explain the difference between an intron and an exon.

A: RNA splicing is one of the processes of post-translational modification in which introns are removed…

Q: Give the specific function of centrosome.

A: A well-known regulator of the cell cycle of the animal cell that is known to microtubule organizing…

Q: Describe the relationship between

A: RNA is ribonucleic acid that is a single stranded nucleic acid composed of ribose sugar. The mRNA…

Q: If the DNA triplet is TTA, then the transcribed MRNA codon would be

A: All living organisms store their genetic information in form of DNA / RNA. This genetic information…

Q: MRNA contains contains O introns O exons both exons and introns

A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…

Q: Codons are...

A: Three nitrogen bases that code for a single amino acid are known as a codon. Codon show some…

Q: Define proteoglycan

A: Extracellular matrix, cell plasma membrane, and intracellular structure include proteoglycans.…

Q: A genetic code in which two bases encode a single amino acid is not adequate for protein synthesis.…

A: The genetic code is a series of rules that living cells use to convert information found in genetic…

Q: Explain why a 50S ribosomal subunit and a 30S ribosomal subunit combine to form a 70S subunit,…

A: Ribonucleoproteins form the basic unit of ribosomes and they are a complex of RNA and proteins. They…

Q: Expressed sequences of DNA are called ________________.

A: DNA or deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around…

Q: Describe the Stages in the formation of a functioning protein in the nucleic acid.

A: Nucleic acid DNA and RNA are polymers of nucleotides.

Q: Describe charging of tRNA or aminoacylation of tRNA.

A: Transfer RNA or tRNA is a special type of RNA, which is useful in decoding the sequence of messenger…

Q: Describe the key structural features of a tRNA molecule.

A: Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles in coding,…

Q: what is the mechanism of translation performed by a ribosome.

A: Translation is a process in which a single stranded RNA sequence formed at the end of transcription…

Q: What is the difference between eukaryotes and prokaryotes in terms of ribosomal subunit binding?

A: Introduction The process of formation of protein from the mRNA is termed as Translation. The three…

Q: If a fragment of nucleic acid has a nucleotide sequence TAC can one assert that it is a codon or an…

A: Nucleic acids are complex bio-polymers present in most organisms. They are composed of nucleotides,…

Q: Describe the components of eukaryotic ribosomal subunits and the location where the assembly of the…

A: Ribosomes are small particles which of RNA and associated proteins that function to synthesize the…

Q: The term subunit can be used in a variety of ways. What is the difference between a protein subunit…

A: Protein is considered as the building block of the body and it is required for the development of…

Q: The relaxation of base-paring rules between the TRNA and mRNA is termed as Answer:

A: Introduction: Ribonucleic acid or RNA is the type of nucleic acid that is mainly present in the…

Q: What are different functions of Different parts of a ribosome

A: Ribosomes are present in an animal cell as well as a plant cell. They are found in the eukaryotic…

Q: The structures within living cells that contain the genetic material is called A Chromosome…

A: Cell is an elemental unit of the body which is involved in various metabolic activities . It…

Q: Difference between Mrna and trna?

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: The job of tRNA is to?

Q: Describe the major structural features of tRNA.

A: Ribonucleic (RNA) nucleic acid, which is of three main types such as mRNA, rRNA, and tRNA and all…

Q: Eukaryotic transcription and translation are similar in that both result in synthesis of

A: Answer: EUKARYOTIC = These are the organisms which have organelles present in the cell.

Q: What is the basic purpose of tRNA?

A: All the information needed to maintain is present in the DNA inside the nucleus. RNA helps in the…

Q: True or false: In the ribosome, a protein enzyme is responsible for connecting the two amino acids…

A: The mechanism of synthesis of protein is known as the translation that takes place in the cytoplasm…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

the function of the small ribosomal
subunits is
O make tRNA template
join amino acids to form a polypeptide
chain
O read the RNA
The combination between two haploid
cells(male and female gametes) during
the fertilization process, will create a:
Cell with one copy of each chromosome,
called zygote
Cell with two copies of each
chromosome, called zygote
Two cells with one copy of each
chromosome, called zygote

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The amino acid sequence of part of a protein has beendetermined:N . . . Gly Ala Pro Arg Lys . . . CA mutation has been induced in the gene encodingthis protein using the mutagen proflavin. The resultingutant protein can be purified and its amino acidsequence determined. The amino acid sequence of themutant protein is exactly the same as the amino acidsequence of the wild-type protein from the N terminus of the protein to the glycine in the preceding sequence. Starting with this glycine, the sequence ofamino acids is changed to the following:N . . . Gly His Gln Gly Lys . . . CUsing the amino acid sequences, one can determinethe sequence of 14 nucleotides from the wild-typegene encoding this protein. What is this sequence?
during anaphase of animal cells, describe the appearance of the DNA, spindle fibers and location of the chromosomes pls do not copy from google
It was clear from the early days of studying devel-opment that certain “morphogenetic” substances werepresent in the egg and segregated asymmetrically intocells of the developing embryo. One such investigationin ascidian (sea squirt) embryos examined endodermalalkaline phosphatase, which could be visualized by a his-tochemical stain. Treatment of embryos with cytochalasinB stopped cell division, but did not block expression ofalkaline phosphatase at the appropriate time. Treatmentwith actinomycin D, which blocks transcription, did notinterfere with expression of alkaline phosphatase. Treat-ment with puromycin, which blocks translation, elim-inated expression of alkaline phosphatase. What is thelikely nature of the morphogenetic substance that givesrise to alkaline phosphatase?
The entire genome of the yeast Saccharomyces cerevisiaehas been sequenced. This sequencing has led to the identification of all the open reading frames (ORFs, gene-sizesequences with appropriate translational initiation andtermination signals) in the genome. Some of these ORFsare previously known genes with established functions;however, the remainder are unassigned reading frames(URFs). To deduce the possible functions of the URFs,they are being systematically, one at a time, convertedinto null alleles by in vitro knockout techniques. The results are as follows:15 percent are lethal when knocked out.25 percent show some mutant phenotype (alteredmorphology, altered nutrition, and so forth).60 percent show no detectable mutant phenotype at alland resemble wild type.Explain the possible molecular-genetic basis of thesethree mutant categories, inventing examples wherepossible.
What establish linkages between the replicated DNAmolecules, which are essential for their accurate segregationlater in the cell cycle. This linking mechanism is coupled toDNA replication.
Amino acid sequences from a cell cycle control protein from a patient with cancer and a healthy person are aligned. The sequence from the cancer patient indicates one amino acid has changed from phenylalanine (Phe) to leucine (Leu). A mutation in the cancer patient's DNA must have taken place. Identify the result of this DNA change in the mRNA codon that led to this change in the protein sequence. Use the codon table to help you. UUU altered to UUA CAA altered to UUU UUU altered to UAU
a) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR:
Given what you know about the structure and functionof telomerase, provide a plausible model to explain howa species could exist with a combination of two differentrepeats (for example, TTAGGG and TTGTGG) on eachof their telomeres
A synthetic chromosome lacking most intergenic sequencesfunctions normally. Such synthetic chromosomes may helpto define a minimal yeast _______________?.
Consider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During RNA transcription, this double-strand molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. Please select all the peptide sequence(s) that could be produced from the mRNA transcribed from this segment of DNA. (Hint: you need to use the genetic codon table to translate the determined mRNA sequence into peptide. Please be reminded that there are more than one reading frames.) Question 6 options: ...-Asp-Cys-Gln-Ser-... ...-Leu-Thr-Val-... ...-Thr-Val-Ser-... ...-Leu-Ser-Val-... ...-Met-Asp-Cys-Gln-...
A research paper published in the summer of 2012presented a method to obtain the whole-genome sequence of a fetus without any invasive procedure suchas amniocentesis that could on rare occasions causemiscarriage. This new technique is based on the factthat some fetal cells leak into the mother’s bloodstream and then break down, releasing their DNA.Assume that exactly 10% of the DNA fragments inthe mother’s blood serum come from the fetus, whilethe remaining 90% of the DNA fragments in the serum come from the mother’s genome.The investigators collected cell-free DNA from apregnant woman’s bloodstream and subjected it to anadvanced high-throughput sequencing method. Thetable at the end of this problem looks at seven unlinked loci; the number of reads of particular alleles(identified by Greek letters) are shown. You shouldassume for the sake of simplicity that all numericaldifferences are statistically significant (even thoughactual data are never this clean).a. Determine whether each…
Histones are: Group of answer choices Are present in eukaryotic, but not prokaryotic chromosomes All of these are true Have tails that can be modified and thereby change how actively a gene is transcribed Generally positively charged Are the protein components of nucleosomes