The genetic map shows the location of three genes on a chromosome. Order the gene pairs based on their likelihood of recombining from most likely to least likely to recombine. Most likely genes A and C A genes A and B В genes B and C Least likely C Answer Bank Incorrect

The genetic map shows the location of three genes on a chromosome. Order the gene pairs based on their likelihood of recombining from most likely to least likely to recombine. Most likely genes A and C A genes A and B В genes B and C Least likely C Answer Bank Incorrect

Name: The genetic map shows the location of three genes on a chromosome. Or
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: The genetic map shows the location of three genes on a chromosome. Order the gene pairs based on their likelihood ofrecombining from most likely to least likely to recombine.Most likelygenes A and CAgenes A and BВgenes B and CLeast likelyAnswer Bank

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter6: Reproduction At The Cellular Level

Section: Chapter Questions

Problem 3RQ: An organism’s traits are determined by the specific combination of inherited ______. a. cells b....

See similar textbooks

Similar questions

• ____________ add DNA to a chromosome and causemutant phenotypes either by increasing gene dosage orby changing the regulation of genes near a breakpoint.
A chromosome territory is a regiona. along a chromosome where many genes are clustered.b. along a chromosome where the nucleosomes are closetogether.c. in a cell nucleus where a single chromosome is located.d. in a cell nucleus where multiple chromosomes are located
An error in meoisis that can result in someone getting the wrong number of copies of a chromosome is called __________. Having the wrong number of chromosomes is referred to as __________.
Genetic linkage occurs becausea. genes that are on the same chromosome may affect thesame character.b. genes that are close together on the same chromosometend to be transmitted together to offspring.c. genes that are on different chromosomes are independentlyassorted.d. none of the above.
Genes code for proteins that determine the phenotypes of individuals. Individualsinherit genes from parents.What is the relationship between genes and chromosomes?A Chromosomes are independent of genes.B Chromosomes are present inside genes.C Genes are made up of chromosomes.D Genes are present on chromosomes.
Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin numerical digits only.
the location on a chromosome where a particular gene is located is known as the A)allele B) dihybirdC) locusD)diploidE) autosome
Alleles are ___________. a. alternate forms of a gene b. different molecular forms of a chromosome c. always homozygous d. always heterozygous
For each species, all ______ in the complete set of chromosomes is/are the _______. a. genomes; phenotype c. mRNA; start of cDNA b. DNA; genome d. cDNA; start of mRNA
In a reduction division, what gets reduced?a. the number of chromosomesb. the number of centromeresc. the number of homologuesd. All of the above.
On rare occasions, an organism may have three copies of achromosome and therefore has three copies of the genes on thatchromosome (instead of the usual number of two copies). Forsuch a rare organism, the alleles for each gene usually segregateso that a gamete will contain one or two copies of the gene. Let’ssuppose that a rare pea plant has three copies of the chromosomethat carries the height gene. Its genotype is TTt. The plant is alsoheterozygous for the seed color gene, Yy, which is found on adifferent chromosome. With regard to both genes, how manytypes of gametes can this plant make, and in what proportions?(Assume that it is equally likely that a gamete will contain oneor two copies of the height gene.)
. All the genes on one chromosome are said to form aa. chromosomal group.b. recombination group.c. linkage group.d. crossing-over group.