The image below shows an amino acid at physiological pH. Answer the following questions about this amino acid. H // -с — с; H3N* CH2 | CH2 H2N a. How many carbons are in this amino acid's side chain? Entry Format: please type your answer as a number. 3 b. Is the side chain of this amino acid ionized at physiological pH? Entry Format: Please type the word yes or no without any capitalization. yes c. At physiological pH, amino acids have two ionic charges, one positively charged group and one negatively charged group. What is the term for this sort of molecule? Entry Format: Please type your response with all lowercase letters.

The image below shows an amino acid at physiological pH. Answer the following questions about this amino acid. H // -с — с; H3N* CH2 | CH2 H2N a. How many carbons are in this amino acid's side chain? Entry Format: please type your answer as a number. 3 b. Is the side chain of this amino acid ionized at physiological pH? Entry Format: Please type the word yes or no without any capitalization. yes c. At physiological pH, amino acids have two ionic charges, one positively charged group and one negatively charged group. What is the term for this sort of molecule? Entry Format: Please type your response with all lowercase letters.

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter3: Molecules Of Life

Section: Chapter Questions

Problem 13SA

See similar textbooks

Similar questions

Describe the amino acid illustrated here (Identify the following amino acid (at pH = 7.0): (COO-)–CH(NH3+)–CH2–CH2–CH2–CH2–(NH3+)) (at pH = 7.0). it is a polar, negatively-charged amino acid it is a non-polar, negatively-charged amino acid it is a polar, positively-charged amino acid it is a non-polar, positively-charged amino acid it is a non-polar, uncharged amino acid
Describe the amino acid illustrated above (at pH = 7.0). (the following amino acid at pH = 7 (aqueous form): (COO-)–CH(NH3+)–CH2–(COO-)) it is a non-polar, positively-charged amino acid it is a polar, positively-charged amino acid it is a polar, uncharged amino acid it is a polar, negatively-charged amino acid it is a non-polar, negatively-charged amino acid
The peptide below contains how many amino acid residues?
Identify the amino acid that will give the following data:
Which of the following is the smallest amino acid?* Please choose one correct answer only. A. G B. A C. P D. W E. D
Give a clear handwritten answer with explanation.....give detailed answer. what is standard amino acid with carbony group and amino group ? please mention all of them
Which letter corresponds to the answer? The L-configuration of this amino acid is important for the synthesis of proteins, membrane components, and nucleotides for making DNA & RNA. a. Glycine b. Methionine c. proline d. serine It is one of the most important amino acids specifically for making almost every protein on Earth. a. Glycin b. Methioninee c. proline d. serine
Which letter in the diagram below is pointing to the amino acid
how many amino acids are in CAGATTGTGAAGAGGTCTCTTGA peptide sequence? Answer in numerical digits only
Identify the following amino acid at pH = 7 (aqueous form): (COO-)–CH(NH3+)–CH2–(COO-) aspartic acid asparagine histidine arginine lysine Describe the amino acid illustrated above (at pH = 7.0). it is a non-polar, positively-charged amino acid it is a polar, positively-charged amino acid it is a polar, uncharged amino acid it is a polar, negatively-charged amino acid it is a non-polar, negatively-charged amino acid How many chiral carbons are present in the above amino acid (in aqueous form)? zero chiral carbons one chiral carbon two chiral carbons three chiral carbons four chiral carbons How many optical isomers (stereoisomers) are possible for the above amino acid (aqueous form)? 21 = 2 optical isomers 22 = 4 optical isomers 23 = 8 optical isomers 24 = 16 optical isomers 25 = 32 optical isomers
Which of the following statements is true about amino acids? a. All twenty (20) of these protein-derived amino acids are a-amino acids, meaning that the amino group is located on the carbon alpha to the carboxyl group. b. For nineteen (19) of the twenty (20) amino acids, the a-amino group is primary. Glycine is different; its a-amino group is secondary. c. With the exception of proline, the a-carbon of each amino acid is a chiral center. As shown in Table 27.1, all 19 chiral amino acids have the same relative d. Both a & c
Which amino acid fits for these lines? a) this amino acid is neither L nor D b) This amino acid has the largest side chain from the 20 amoni acids c) This amino acid has a side-chain that has three nitrogen atoms and can carry a positive charge d) this amino acid has a side chain that is covalently bound to its alpha amino group e) This amino acid has the side chain that most closely resembles ethanol f) this amino acid has a side-chain that is an aromatic alcohol g) at pH 6, this amino acid has a side chain that is about half- protonated and half-deprotonated h) this amino acid is not ASP, but like ASp it has a side chain that can bind to an anion exchange chromatography column by electrostatic interactions at pH 5