Figure 2 is a schematic drawing of ABC gene, which encodes ABC protein.Transeriptional terminatorPromoterIntron 1Intron 21 1002100310041005100 base pairs1100Positions 200-203 Start codonPositions 4800-4802 = Stop codonFigure 2.The transcript from ABC gene that is used for translation would beapproximately how many nucleotides long?

Name: Figure 2 is a schematic drawing of ABC gene, which encodes ABC protei
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Figure 2 is a schematic drawing of ABC gene, which encodes ABC protein.Transeriptional terminatorPromoterIntron 1Intron 21 1002100310041005100 base pairs1100Positions 200-203 Start codonPositions 4800-4802 = Stop codonFigure 2.The transcript from AB

Introduction: Gene is a unit of heredity. It contains the genetic information. It is made up of DNA.…

Science

Biology

Figure 2 is a schematic drawing of ABC gene, which encodes ABC protein. Transeriptional terminator Promoter Intron 1 Intron 2 1 100 4100 5100 base pairs 1100 2100 3100 Positions 200-203 Start codon Positions 4800-4802 = Stop codon Figure 2. The transcript from ABC gene that is used for translation would be approximately how many nucleotides long?

Figure 2 is a schematic drawing of ABC gene, which encodes ABC protein. Transeriptional terminator Promoter Intron 1 Intron 2 1 100 4100 5100 base pairs 1100 2100 3100 Positions 200-203 Start codon Positions 4800-4802 = Stop codon Figure 2. The transcript from ABC gene that is used for translation would be approximately how many nucleotides long?

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 20RQ: A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of...

See similar textbooks

Similar questions

Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of elF-2 alter translation? Initiation factors would not be able to bind to mRNA The large ribosomal subunit would not be able to interact with itiRNA transcripts tRNAi-Met would not scan mRNA transcripts for the start codon elF-2 would not be able to interact with the small ribosomal subunit.
Figure 29.15 highlights in red the DNA phosphate oxygen atoms. Some of them interact with catabolite activator protein (CAP). What kind of interactions do you suppose predominate, and what kinds of CAP amino acid side chains might be involved in these interactions?
Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.
The following represents a transcription unit in a hypothetical DNA molecule in E.coli. (Transcription can use either strand, but by convention we always put 5’à 3’ on the top.) 5’…..TTGACANNNNTATAAT…3’ 3’…..AACTGTNNNNATATTA…5’ If this molecule is transcribed from left to right, then the ____ strand will be the template strand and the ___ strand will be the non-template strand. top, bottom bottom, top
The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.
Choose from the following: 5'cap, exon, a site, promoter, p site, intron, AAUAAA, start condon 1. Protects transcript from enzymatic degradation 2. Polyadenylation signal 3.Accepts the incoming charged tRNA 4.Upstream sequence region to which transcription factors and RNA polymerase are recruited. 5.Complementary to tRNA carrying methionine 6.segment of transcript that codes for protein
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ Q.Where, approximately, will the transcription start site be?
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ Q. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand?
For the following characteristics, state whether they are true for the 5' CAP, the Poly-A tail, BOTH modifications, or NEITHER modification. Briefly (1 sentence) support your answer. Promotes translation of the mRNA at the 3' end. Acts to prevent degradation of the mRNA by exonucleases. Promotes splicing of the mRNA. Promotes binding of transcription factors to the Mediator complex.
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.