Figure 2 is a schematic drawing of ABC gene, which encodes ABC protein. Transeriptional terminator Promoter Iatron 1 Intron 2 1 100 s100 base pairs 1100 2100 3100 4100 Positions 200-203 Start codon Positions 4800-4802 Stop codon Figure 2. (i) The transcript first produced by ABC gene would be approximately how many nucleotides long?

Figure 2 is a schematic drawing of ABC gene, which encodes ABC protein. Transeriptional terminator Promoter Iatron 1 Intron 2 1 100 s100 base pairs 1100 2100 3100 4100 Positions 200-203 Start codon Positions 4800-4802 Stop codon Figure 2. (i) The transcript first produced by ABC gene would be approximately how many nucleotides long?

Name: Figure 2 is a schematic drawing of ABC gene, which encodes ABC protei
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Figure 2 is a schematic drawing of ABC gene, which encodes ABC protein.Transeriptional terminatorPromoterIntron 1Intron 21 100s100 base pairs1100210031004100Positions 200-203 = Start codonPositions 4800-4802 = Stop codonFigure 2.(i)The transcript fi

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ a. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism? b. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand? c. Where, approximately, will the transcription start site be?
Given the sequence of triplet codons: 5′-TAC AAA ATA CAG CGG-3′, write out one of each: transition; transversion; silent; missense; nonsense; frameshift mutations;
The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?
What will be the overall anti-codon sequence in tRNA for this mRNA? 5’-GUAGCCUUAUCUAGCGAUCACCGUCCGUAUUACUAGUGGCCAGACUCUUUUCACCAUGUAUAGUUG-3’
Given Sequence: 3’-TACGGTCCGGATTCGGTAGCTAGCATC-5’ Provide: Complementary Strand: Transcript Amino Acid Sequence 2.Given Sequence: 5’-GGGCATATGCCGTTTACCGGTTTGACTAAATAACCA-3’ Provide: Complementary Strand: Transcript Amino Acid Sequence 3.Given Sequence: 3’-AAC CAA TAC GTG AGG ATA CCA AGT AAC ACT CCC-5’ Provide: Complementary Strand: Direct Transcript: Transcript for Translation: Amino Acid Sequence:
The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?
Shown below are three genes (gene 1, gene 2, and gene 3) located on the same bacterial chromosome. a) Indicate where on the diagram you would find the following for each gene: Promoter (p1 for gene 1, p2 for gene 2, and p3 for gene 3) Transcription termination site (tts1, tts2, and tts3) Start codon (start1, start2, and start3) Stop codon (stop1, stop2, and stop3) Template strand (ts1, ts2, and ts3), the DNA strand that directs RNA synthesis Be sure to indicate the component on the appropriate molecule (DNA or RNA).
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ Q.Where, approximately, will the transcription start site be?