The sequence below represents the template strand of DNA of the first two exons (out of 5) of a structural gene in an eukaryote organism. The intron(s) are marked in lowercase. what would be the mature RNA of this section? DNA: 3'TGGACAGgtaagaataGTCGGC 5'

The sequence below represents the template strand of DNA of the first two exons (out of 5) of a structural gene in an eukaryote organism. The intron(s) are marked in lowercase. what would be the mature RNA of this section? DNA: 3'TGGACAGgtaagaataGTCGGC 5'

Name: 31. Mature a mRNA strand.The sequence below represents the template st
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 31. Mature a mRNA strand.The sequence below represents the template strand of DNA of the first two exons (out of 5) of a structural gene in an eukaryote organism.The intron(s) are marked in lowercase. what would be the mature RNA of this section?DNA:

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Which choice best fits the blank? Refer to picture. The ribosome moves along the mRNA strand. In panels b, c, and d, new tRNAs carrying ___________. match up with the codons of the mRNA strand. After each tRNA locks into place, a peptide bond forms between the amino acid the tRNA is carrying and the amino acid already there. This process repeats until the end of the sequence is reached. A. ProteinsB. NucleotidesC. Amino Acids
BIOLOGY ACTIVITY -Gene Mutations and Proteins Objective: To demonstrate how gene mutations affect the production of proteins? Procedure: Use the following base sequence of one strand of an imaginary DNA molecule: AATTGAACACATGCGCCC. 2. Write the base sequence for an mRNA strand that would be transcribed from the given DNA sequence. Place your results in the table below. Use your codon table provided below to determine the sequence of amino acids in the resulting protein fragment. Place your results in the table below. If the fifth base in the original DNA strand were changed from G to C, how would this affect the resulting protein fragment? Write the new protein fragment in the table below. If G were added to the original DNA strand after the third base, what would the resulting mRNA look like? How would this addition affect the protein? Show your results in the table below. Data: mRNA from Step 2 Protein Sequence from Step 3 Protein Sequence from Step…
Let’s practice making a strand of mRNA. Finish what we started: DNA: T-A-C-T-T-A-C-A-C-G-T-C-A-A-C-G-T-G-C-C-T-T-A-G-C-C-A-T-TmRNA: A-U-GGo ahead and write out the complementary strand of mRNA above
VISUALIZE Sketch a pyrimidine nucleotide subunit that would be found only in RNA. Circle and label the three components that make up this type of nucleotide. Explain what changes in the functional groups of this subunit would have to occur for it to be found in a DNA molecule.
Exploring the Structure of the 30S Ribosomal Subunit Go to www.pdh.org and bring up PDB file 1GIX, which shows the 30S ribosomal subunit, the three tRNAs, and mRNA. In the box on the right titled â€˜Biological Assembly.â€� click â€œMore Images.â€� and then scroll down to look at the Interactive Vic By moving your cursor over the image, you can rotate it to view it from any perspective. a. How are the ribosomal proteins represented in the image? b. How is the 16S rRNA portrayed? c. Rotate the image to see how the tRNAs stick out from the structure. Which end of the tRNA is sticking out? d. Where will these ends of the tRNAs lie when the 50S subunit binds to this complex?
a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
RNA polymerase from E. coli (core enzyme alone) has all of the following properties except: a)requires all four ribonucleoside triphosphates and a DNA template. b)can extend an RNA chain and initiate a new chain. c)recognizes specific start signals in DNA. d)produces an RNA polymer that begins with a 5'-triphosphate. e)is required for the synthesis of mRNA, rRNA, and tRNA in E. coli.
True or false?: The CTD is responsible for mRNA-processing steps that are specific for mRNA and not for other forms of RNA. Explain why you chose true or false.
Structural Stability of DNA True or false Hydrophobic bonding between stacked purine and pyrimidine Hydrogen bonding between purine and pyrimidine bases Hydrogen bonding between adjacent pyrimidine bases tRNA True or false A given tRNA can be charged with only one particular amino acid The anticodon of tRNA finds the complementary codon on mRNA The amino acid is attached to end of tRNA The amino acid is recognized by the anticodon of tRNA
Mutations: The codon GGA encodes the amino acid glycine. Identify the type of mutation for each of the following changes (name both the type of mutation and what the new codon would produce): GGA to GGG GGA to UGA GGA to GAGA GGA to AGA
DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:
Hi, Could you please comfirm the following question. I have selected option c) because tRNA is the the complimentary pairs of mRNA so I figured the oppside end of the tRNA would be the same as the mRNA. When I have tired to double check my answer, no tutor has selected this answer. Thank you in advance, Like mRNA, tRNA has a ribose sugar, U instead of T, and is single stranded. Unlike mRNA, which remains a long single strand of nucleotides, tRNA folds so that some areas pair up. The resulting structure has an anticodon on one end and a site for an amino acid to attach on the other end. There is base complementarity (A pairs with U and G pairs with C) between an mRNA codon and tRNA anticodon.If the amino acid lysine attaches to a tRNA, which of the following anticodons could be at the opposite end of the tRNA molecule? a. UUU and UUC b. AGA and AGU c. AAA and AAG d. UCU and UCA