Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 30, Problem 17P
Exploring the Structure of the 30S Ribosomal Subunit Go to www.pdh.org and bring up PDB file 1GIX, which shows the 30S ribosomal subunit, the three tRNAs, and mRNA. In the box on the right titled ‘Biological Assembly.� click “More Images.� and then scroll down to look at the Interactive Vic By moving your cursor over the image, you can rotate it to view it from any perspective.
a. How are the ribosomal proteins represented in the image?
b. How is the 16S rRNA portrayed?
c. Rotate the image to see how the tRNAs stick out from the structure. Which end of the tRNA is sticking out?
d. Where will these ends of the tRNAs lie when the 50S subunit binds to this complex?
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Please help with all parts of A, B, C, D
2. You are studying the function of a messenger RNA named Genetixrox and want to label themRNA with a radioactive atom. Assume the mRNA is long and contains all four standardRNA bases. Assume that the cell cannot convert ribonucleotides to deoxyribonucleotides (orvice versa).A. Will you generate radioactive Genetixrox mRNA with 3H-threonine? Threonine is an aminoacid. Answer yes or no, and provide a one sentence rationale.B. Will you generate radioactive Genetixrox mRNA with 3H-adenosine triphosphate? Answeryes or no, and provide a one sentence rationale.C. Will you generate radioactive Genetixrox mRNA with 3H-deoxyadenosine triphosphate?Answer yes or no, and provide a one sentence rationale.D. Will you generate radioactive Genetixrox mRNA 12C-with adenosine triphosphate? Answeryes or no, and provide a one sentence rationale
My PDB code: 3GRS
residue point: HIS467
mutation: LEU
Describe why this position in your protein is important and outline the effects the mutation will have on the 3D structure and the function of your protein. (up to 50 words)
Please explain why it is useful that our RNA is read in codons. Imagine a hypothetical scenario where there are 95 amino acids and only 6 nucleotides available. Calculate how many nucleotides per codon would be required to code for all 95 amino acids. Show and explain your work.
Chapter 30 Solutions
Biochemistry
Ch. 30 - Prob. 1PCh. 30 - Prob. 2PCh. 30 - The Second Genetic Code Review the evidence...Ch. 30 - Codon-Anticodon Recognition: Base-Pairing...Ch. 30 - Consequences of the Wobble Hypothesis Point out...Ch. 30 - Prob. 6PCh. 30 - Prob. 7PCh. 30 - Prob. 8PCh. 30 - Prob. 9PCh. 30 - The Consequences of Ribosome Complexity Eukaryotic...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′arrow_forwardReferring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′arrow_forwardThe Second Genetic Code Review the evidence establishing that aminoacyl-tRNA synthetases bridge the information gap between amino acids and codons. Indicate the various levels of specificity possessed by aminoacyl-tRNA synthetases that are essential for high-fidelity translation of messenger RNA molecules.arrow_forward
- Alternative Splicing Possibilities Suppose exon 17 were deleted from the fast skeletal muscle troponin T gene (Figure 29.46). How many different mRNAs could now be generated by alternative splicing? Suppose that exon 7 in a wild-type troponin T gene were duplicated. How many different mRNAs might be generated from a transcript of this new gene by alternative splicing?arrow_forwardPlease help me complete this solution, i cant figure out what is incoorect about this statement... is the Rrna nee to be repleced with Trna?arrow_forwardNeed help:. Researchers add poly-(CGU) to an in vitro TL system. What poly-amino acids are produced? How would the researchers determine which codon encoded each of these amino acids? 5’CGUCGUCGUCGUCGUCGUCGUCGU...3’arrow_forward
- The sequence below shows the non-coding strand from the whole of the transcribed region of a very short gene. 5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’ Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).arrow_forwardGive typing answer with explanation and conclusion to all parts Consider the following DNA mRNA sequence: 5’-ACTGATCCATGCCAGGGGTTTTCAACTAAAATGAAA-3’ a) What is the template sequence this mRNA was transcribed from? Include 5’ and 3’ labels. b) Based on this sequence, what you predict would be the resulting peptide sequence from it. c) In examining this sequence what is the proper reading frame of the open reading frame? (+1, +2, +3, -1, -2, or -3). d) What would you predict the peptide sequence to be if there was the following mutation that led to a base change: 5’-ACTGATGCATGCCAGGGGTTTTCAACTAAAATGAAA-3’arrow_forwardTranslation of mRNA Using the codon chart provided, translate the following messenger RNA sequence into an amino acid sequence (protein). AUG AAA GGU CAC CCC TAGarrow_forward
- Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA–3′arrow_forwardHi, Could you please comfirm the following question. I have selected option c) because tRNA is the the complimentary pairs of mRNA so I figured the oppside end of the tRNA would be the same as the mRNA. When I have tired to double check my answer, no tutor has selected this answer. Thank you in advance, Like mRNA, tRNA has a ribose sugar, U instead of T, and is single stranded. Unlike mRNA, which remains a long single strand of nucleotides, tRNA folds so that some areas pair up. The resulting structure has an anticodon on one end and a site for an amino acid to attach on the other end. There is base complementarity (A pairs with U and G pairs with C) between an mRNA codon and tRNA anticodon.If the amino acid lysine attaches to a tRNA, which of the following anticodons could be at the opposite end of the tRNA molecule? a. UUU and UUC b. AGA and AGU c. AAA and AAG d. UCU and UCAarrow_forwardInstructions: Express your own gene! (1) Make up a DNA sequence of at least 18nucleotides and then (2) show the mRNA sequence that will be made via transcription,(3) show the tRNAs that will base pair and deliver the amino acids, and (4) the aminoacid sequence of the resulting protein. You can use the single letter abbreviations forDNA and RNA nucleotides and the three-letter abbreviations for the amino acids.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY