If the amino acid lysine attaches to a tRNA, which of the following anticodons could be at the opposite end of the tRNA molecule? a. UUU and UUC b. AGA and AGU c. AAA and AAG d. UCU and UCA
Q: Which of the following events would NOT result in ribosomes stalling on an MRNA during translation?…
A: A release factor is a protein that recognizes a stop codon in an mRNA sequence and causes…
Q: This is a homework question that I have on my Adv. Anatomy & Physiology assignment. How to I got…
A: The hypothetical protein considered here consists of the amino acid sequence arginine,…
Q: What would be the direct consequence to a cell of loss-of-function of Elongation Factor-Tu (EF-Tu)?…
A: EF-Tu is a highly conserved elongation factor in prokaryotes. It catalyzes the binding of tRNA…
Q: Which of the following statements about translation is false? In eukaryotes, the 5' cap and…
A: In molecular biology, the process by which the gene information in the DNA gets converted into a…
Q: Please help me find the protein sequence in reference to the text below. "mRNA Sequence…
A: Cell is the basic structural and functional unit of life. The nucleus in the cell contains the…
Q: Suppose an mRNA transcript with the following base sequence reaches a ribosome: 5'-…
A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA that codes for a specific…
Q: rom the mRNA base sequence CUU-AUG-GCU-UGG-CCC-UAA A.What anticodon sequences of tRNA’s are coded?…
A: Anticodon- It is a sequence of three ribonucleotide on tRNA , which is complementary to a codon on…
Q: The antibiotic erythromycin disrupts protein synthesis by binding to the 50 S subunit and preventing…
A: tRNA is the transfer RNA . It is the smallest of three major species of RNA molecule. They transfer…
Q: segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following…
A: For protein synthesis, messenger RNA must be made from one strand of DNA called the template strand.…
Q: Choose the correct option for following three mcqs 16.Termination codons differ from other codons…
A: Note: Please upload other questions separately. Answer: Introduction: A codon means an order of…
Q: Below is the template DNA sequence for an entire (short) gene that contains no introns. TRANSCRIBE…
A: The Central Dogma of Biology DNA --(Transcription)-- RNA --(Translation) -- Protein It says that…
Q: Label the 5' and 3' ends of DNA and RNA and the amino and carboxyl ends of the protein. Assume it is…
A: DNA is the genetic material in all the living cells.
Q: During translation elongation cycle, which of the following step(s) is/are repeated for each amino…
A: Translation is a process by which proteins are synthesized from mRNA template. It involves all the…
Q: Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide…
A: Ribosomes are sphere-shaped structure present within the cytoplasm of a cell. They are composed of…
Q: Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the…
A: Introduction The process of duplicating a DNA molecule is known as DNA replication. When a cell…
Q: Complete the phrases with the correct word or words. The task is to match the lettered items with…
A: Genes are sets of nucleotides that codes for a particular protein. The genes have to be expressed…
Q: Which of the following statements about protein elongation are correct? I. There is a nucleophilic…
A: Replication, transcription and translation are basic mechanisms performed by genetic material along…
Q: The 3 major forms of RNA (mRNA, tRNA, & rRNA) interact during translation. c)Compared to the…
A: Ribonucleic acid (RNA) is a nucleotide polymer composed of AUGC bases. RNA plays an important role…
Q: Need help Below is a strand of mRNA with three codons listed on the strand. Imagine the mRNA strand…
A: Translation is a process of reading of mRNA to form proteins. It requires several components ljke…
Q: Suppose the DNA sequence of a gene with 5 exons contains a mutation at the 5’ end of intron 2.…
A: The protein translation is the process of the formation of proteins from the mRNA formed from the…
Q: an anticodon on one end and a site for an amino acid to attach on the other end. There is base…
A: Translation :- It is the process by which a protein is synthesized from the information contained…
Q: Give the amino acid sequence of the protein encoded by the mRNA in Figure 15.21.
A: Translation is the process of formation of protein by decoding the nucleotide sequence of an mRNA.…
Q: Discuss why you think the ribosomes need to contain so many proteins and rRNA molecules. Does it…
A: Ribosomes are present in both plant and animal cells. they are present in both prokaryotic and…
Q: After being irradiated, the gene coding for the E site is mutated, causing the E site to have a…
A: Mutations are the random changes in the DNA of organisms.
Q: tRNA True or false A given tRNA can be charged with only one particular amino acid The anticodon…
A: Transfer RNAs- Transfer ribonucleic acid is an RNA molecule that aids in the translation of a…
Q: You perform a series of experiments on the synthesis of the pituitary hormone prolactin, which is a…
A: In case of third experiment, both SRP (signal recognition particle) and endoplasmic reticulum…
Q: Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to…
A: Genetic codon It is a group of three nucleotide that code for amino acids. They are total 64…
Q: Explain the interactions of specific tRNA with its synthetase, by including the importance of…
A: Answer) Cloverleaf structure of tRNA: It is formed due to the intramolecular hydrogen bonds and…
Q: As we focused on the translation of mRNA into proteins as well as on protein structure and function.…
A: tRNA : It is an adaptor molecule composed of RNA, typically 76 to 90 nucleotides in length, that…
Q: inans 5' 3' MRNA For our Unit 12 discussion on gene expression, please answer the following: 1.…
A: The genetic material in the cell contains various genes that codes for mRNA ( messenger RNA) by…
Q: subunlt Small subunit 5' 3' MRNA For our Unit 12 discussion on gene expression, please answer the…
A: The genetic code is essentially a collection of "rules" that a cell utilises to decipher the…
Q: Metenkephalin is a small peptide found in animal brains that has morphine-like properties. Give an…
A: DNA is transcribed into mRNA. The mRNA contains a tripeptide sequence known as codons that code for…
Q: Ribosome Amino Acid Ribosome large subunit TRNA UCUAGAG MRNA Ribosome small subunit Figure:…
A: After the process of transcription, mRNA is formed which is translated into protein molecules by the…
Q: Renata enzymatically conjugates a l"C-labeled cysteine to a transfer RNA (TRNA), with a UGU…
A: Transcription involves the copying of information from a strand of DNA into a new molecule of…
Q: A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What…
A: Translation is the mechanism by which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…
Q: UGGGCUGGUGCCGAGAAAGUUAGGUAA-3' What is the name of the sixth amino acid in the protein formed from…
A:
Q: In Figure 9-17, what do you think happens next to theribosomal subunits after they are finished…
A: To form a particular amino acid chain, or polypeptide, messenger RNA (mRNA) is decoded in a ribosome…
Q: Choose the correct sequence for Translation process. 1. Translocation of the large subunit 2.…
A: Introduction :- The process of decoding the genetic code contained within a messenger RNA (mRNA)…
Q: A series of tRNAs have the following anticodons. Consider the wobble rules listed in Table and give…
A: Genetics is a branch of science that deals in the study of genes, heredity, and genetic variation of…
Q: which level of structure describes non watson crick intercations in trna
A: According to Watson and crick, the DNA is a nucleotide, it is made up of sugar, nitrogenous base,…
Q: BONUS: In Bacteria, catalyzes formation of peptide bonds during translation (answers must be in…
A: RNA nucleotides are linked together by 3’-5’ phosphodiester linkages. The three min RNA in all the…
Q: specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from ts…
A: INTRODUCTION Amino acids are the building blocks of proteins and nitrogenous backbones of…
Q: What is the importance of the anticodon on the tRNA?
A: DNA contains both coding and non-coding region where introns are non-coding regions and exons are…
Q: Why mRNA is much more variable in its 3-dimensional shape than is DNA? does there is implications of…
A: Introduction DNA and RNA are the main genetic material found in all the species irrespective of…
Q: You want to translate a polycistronic bacterial MRNA in eukaryotic cells. You remove all stop codons…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: If the amino acid serine attaches to a tRNA, which of the following anticodons could be at the…
A: tRNA tRNA or transfer RNA is a Kind of RNA molecule that decode the code of mRNA and brings amino…
Q: Prokaryotic mRNAs have a RBS (Ribosomal binding site). How they use RBS for translational machinery?…
A: Translation is synthesis of protein from the m-Rna and this occurs in the cytoplasm as all the…
Q: Having studied the process by which DNA directs the synthesis of proteins, you should be ready to…
A: Transcription is the process of formation of RNA transcript form the segment of DNA that is called…
Q: The genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into…
A: According to the genetic code, a set of three nucleotides, that isis the triplet code for a…
If the amino acid lysine attaches to a tRNA, which of the following anticodons could be at the opposite end of the tRNA molecule?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Explain the interactions of specific tRNA with its synthetase, by including the importance of cloverleaf structure of tRNA, which domains are involved, distinct recognition sites, D-arm, TψC arm, anticodon loop and stem, linkage, activation, amino acceptor arm, ensuring the correct tRNA to be recognized by its synthetase. Please do not answer with an incredibly long reply. I would just like the most condensed answer possible by providing all key points asked about. Thanks!in the endoplasmic reticulum and Golgi-complex, the determination of proper folding depends on what type of post- translational modifications? help me to understand what the answer is as i am doing correction so i can get points back.Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′
- From the mRNA base sequence CUU-AUG-GCU-UGG-CCC-UAA A.What anticodon sequences of tRNA’s are coded? B.What was the base sequence in the original DNA strand was made? Please answer completely will give rating surely Both questions answers neededThe images shown depict the initiation and elongation steps in protein translation. Arrange the images in the order in which these steps occur. A. B A C D B. B D A C C. C D A B D. A B C DNeed help Below is a strand of mRNA with three codons listed on the strand. Imagine the mRNA strand is in the cytoplasm of a cell and translation is in progress. Draw and label all the necessary main players needed for translation to occur. Included in your drawing should also bee 3 tRNAs , these 3 tRNAs should represent two different forms of tRNA. MRNA 5' ------------AUG------------AGG----------GAG
- The following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…A mRNA has the following sequence and direction: 5’-AUGUCAACCUAA-3’ What would be the anticodon sequences formed from this mRNA during the translation process?What would be the direct consequence to a cell of loss-of-function of Elongation Factor-Tu (EF-Tu)? You may select multiple answers. a. tRNAs would fail to exit the E site after giving up their amino acid. b. The error rate of translation would increase. c. The ribosome would frequently fail to identify the correct start codon and initiation of translation would become less efficient. d. There would be no pause between the entry of a tRNA into the A site and peptidyl transfer.
- Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’An mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’Please answer these questions, I provided a picture of the codon table. 1. Below is the template DNA sequence for an entire (short) gene that contains no introns. TRANSCRIBE this entire gene sequence: 3'- T C G A C T A C C A T G G T G T C A G A A T T T G T G G -5' 2. TRANSLATE the gene sequence, using the same rules that a ribosome would use on it. 3. Describe what you did in order to translate this sequence. (2-3 sentences) 4. IF the TGGTG sequence in the middle of this gene were an intron, then would this alter the translation that you just performed? Explain your answer. (2-4 sentences)