30/The ste at which the process of DNA replication begins at isA origin of replicationB promoterC signal sequenceD TATA boxE intron

Name: 30/The ste at which the process of DNA replication begins at isA orig
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 30/The ste at which the process of DNA replication begins at isA origin of replicationB promoterC signal sequenceD TATA boxE intron

The process by which DNA duplicates itself is called DNA replication. This is one of the step in the…

Answered: The ste at wheh the process of DNA…

Science

Biology

The ste at wheh the process of DNA replication begins at s A origin of replication B promoter C signal sequence D. TATA box E intron

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 8SA: DNA replication requires ________ . a. DNA polymerase c. primers b. nucleotides d. all are required

See similar textbooks

Related questions

Q: double-stranded RNA

A: ribonuclease III family Enzymes from the ribonuclease III family bind and cleave…

Q: This device is called * LETRAGUT SOUTH Orotary microtom O freezing microtom O ultramicrotom O…

A: Microtome is a specialised precision cutting instrument. It accurately and repeatedly slices…

Q: In a randomly breeding population, the frequency of the dominant allele (D) is 0.8. The relative…

A: According to our company policy, We have supposed to first question in case of multiple question.…

Q: Among a particular population of 100 plants, red flowers are dominant and yellow flowers are…

A: Introduction The population is some of all interacting individuals of a particular species in a…

Q: I live in the forests of Southeast Asia. I am arboreal and swing through trees. I have Y-5 molars,…

A: All the primates under super family Hominoidea consists of Y-5 molar teeth. This super family…

Q: There is a report of a new disease affecting approximately 30% of the persons living in a small…

A: Introduction Infectious diseases are illnesses caused by bacteria, viruses, fungus, or parasites.…

Q: 4. a) is the energy required for this process? b) What is the experimental evidence? 5. a) Did the…

A: Introduction The movement of materials across cell membranes is referred to as cell transport.…

Q: What is expected to happen to the f(a) when the population is experiencing gene flow from another…

A: 1) Gene flow is the migration of a gene from one population to another. It occurs when some…

Q: ww20 In a randomly breeding population, the frequency of the dominant allele (D) is 0.8. The…

Q: For many enzymes, it is important to exclude water from the active site. Explain in your own words…

A: Enzymes are proteins produced by living organisms to catalyze specific metabolic and biochemical…

Q: 1.What is the difference between the CNS and the PNS?

A: Introduction The nervous system is a highly complex part of an animal that organises its actions…

Q: Match each antibacterial drug with its primary target. Chloramphenico✓ Choose... Nucleic acid…

A: Sol: Antibacterial drug is chemical substances which are obtained from biological source or produced…

Q: In a randomly breeding population, the frequency of the dominant allele (D) is 0.8. The relative…

A: Introduction Evolution is a process involving a change in the genetic composition of a population…

Q: 1. You make a recombinant plasmid vector that contains an insert of a gene you are interested in…

A: Gel electrophoresis separates the DNA on the basis of its size. The DNA is loaded on the well on the…

Q: Before arrano acads can enter to glycolysis and the CA wo group must be removed by a process A…

A: The amino acids have the amino groups and the carboxylic groups in their structure. When amino acids…

Q: O a currently used synonym for nicotine O the main breakdown product of nicotine O the first name…

A: Drugs Drugs are the molecules or substances that when consumed (ingested/injected/ inhaled) produce…

Q: Briefly describe the differences and similarities of RNA and DNA. – Know the difference in their…

A: Introduction DNA:- Deoxyribonucleic acid: It is a long-chain polymer of two polynucleotide chains…

Q: 1)HSP 70 is a chaperone protein that aids the folding of newly formed polypeptides during…

A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: A 44-year-old patient is hospitalized with complaints of severe abdominal pain. After the surgical…

A: Mesenteric Thrombosis occurs when the blood clot forms in one or more of the major veins which…

Q: 38/ 50 Translation reques A mRNA tRNA and rRNA 8 mRNA DNA and rRNA C. mRNA, IRNA, DNA, and rRNA D…

A: translation can be defined as the process of converting nucleic acid information into amino acids.…

Q: glass knive used in scaninng electron microscope preparation O true O False

A: Introduction A microscope is a scientific tool that is used to investigate items that are too small…

Q: In a table, illustrate the differences between natural, artificial, active and passive immunity with…

A: Immunity On exposure to a certain infection, our body produces respective fighting agents…

Q: Briefly explain the relationship between substrate concentration and enzyme activity and be sure to…

A: Introduction The rate at which enzymes transform substrate molecules into product molecules is…

Q: You have access to the sequence genomes for moss and the lycophyte Selaginella. Your goal in…

A: Introduction Plants that lack a vascular system made up of xylem and phloem are known as…

Q: 94 In the arrested state (7-14 nucleotides) of elongation, ( ) is required to reactivate…

A: In molecular biology, the central dogma explains a lot about the transcription and translation in…

Q: What is expected to happen to the frequency of an allele B in a very small population of…

A: Interbreeding population are the one which can breed with other species too rather than same…

Q: A45-year-old man comes to the emergency department because of increasingly frequent episodes of…

A: The Human Body consists of several different organs, of which the stomach performs the function of…

Q: 1 laryngeal prominence 2 3 -4 eustachian tube lower jaw 6 5'

A: The given diagram shows the buccal cavity of a frog. The frog is an amphibian that belongs to the…

Q: 1. Cancer of the white blood cells is called leukemia. Like other cancers, leukemia is associated…

A: Introduction Cancer is a term used to describe a group of diseases characterised by abnormal cell…

Q: Which stage of photosynthesis makes products like ATP and NADPH? the light dependent reactions the…

Q: 91 The mRNA Shine-Dalgarno sequence interacts with 26S rRNA anti-Shine-Dalgarno sequence. Yes or…

A: Transcription is the process of RNA synthesis from the DNA template. It occurs within the nucleus of…

Q: 46 What is the A-site of the ribosome? A. exit site b. aminoacyl-tRNA binding site c. peptidyl-tRNA…

A: Ribosomes are the protein factories of the cell. These are responsible for protein synthesis by…

Q: What is the difference between PAMP and antigen?

A: The immune system is studied in immunology. The immune system is a collection of cells, tissues, and…

Q: 97 Which of the following is examples of a transposable element found in bacteria? (multiple choice…

A: Note- we are supposed to answer three question according to our guidelines, please repost other…

Q: Based on the renal statements below, please choose the correct answer 1. GFR Krx Net filtration…

A: Introduction The excretory system is a passive biological mechanism that eliminates excess,…

Q: What are the issues with GMO crops and all four of the principles of bioethics?

A: GMOs are organisms (plants, animals, or microbes) whose genetic material (DNA) has been altered in a…

Q: The photosynthetx electron transport causes the accumon of protons n which part of the chloroplast?…

A: A process in phototrophic organisms which helps in generating the chemical energy with the help of…

Q: What’s the significance of studying the different stages of a chick embryo?

A: Developmental Biology is the branch of Biological Sciences that deals with all the mechanisms…

Q: A 44-year-old patient is hospitalized with complaints of severe abdominal pain. After the surgical…

A: The superior mesenteric artery provides the oxygenated blood and nutrients to the intestines. These…

Q: 1. Illustrate. Consider the given pair of homologous DNA molecules. W X Y W' X' Y' w' x' W X y Z…

A: A Holliday junction is a nucleic acid structure with four double-stranded arms that are linked…

Q: Discuss how animals and plants influence intake in a rangeland

A: Rangelands Rangelands are natural desertlands, wetlands, grasslands, shrublands and woodlands which…

Q: A possible explanation for the increased incidence of Tay-Sachs disease among Ashkenazi Jews is

A: Tay Sachs is a rare autosomal recessive disorder that causes mental and physical disabilities…

Q: When there is an abnormality of the thyroid gland, a goiter can form. Choose the INCORRECT…

A: Introduction: The thyroid gland is a tiny organ that wraps around the windpipe in the front of the…

Q: 4 ______________ studies revealed that some mRNA molecules are formed by splicing pre-mRNA.…

A: 4 ______________ studies revealed that some mRNA molecules are formed by splicing pre-mRNA.…

Q: 1. You are interested in the eukaryotic protein/enzyme Thiolase, which is 200 amino acids in length.…

A: Proteins are synthesized on the ribosomes that are either bound to the endoplasmic reticulum, or…

Q: Question 13 ✓ Saved Listen After the inflection point on the logistic growth curve: The population…

A: Introduction :- When resources are scarce, populations (b) expand logistically. When resources…

Q: 2 Why is the slowing of the cilia lining the bronchi especially dangerous?

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: In the following paragraph, please fill in the blanks with one of the terms in the following list,…

A: Living organisms depend on Oxygen for survival. They take in atmospheric oxygen and this is what…

Q: 34. in an experimental study of skeletal muscle function, an isolated muscle strip is electrically…

A: Muscle tension Muscle tension interchangeably called "muscle force" is the amount of force produced…

Q: n in what ways does the west nile virus impact human health

A: Viruses are minute organisms that can only be seen under a microscope. DNA or RNA, circular or…

Concept explainers

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.

Topic Video

Question

30/
The ste at which the process of DNA replication begins at is
A origin of replication
B promoter
C signal sequence
D TATA box
E intron

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following components is not involved during the formation of the replication fork? single-strand binding proteins helicase origin of replication ligase
The phrase "5 prime to 3 prime" refers to the ______. a. timing of DNA replication b. directionality of DNA synthesis c. number of phosphate groups
When DNA replication begins, ______. a. the two DNA strands unwind from each other b. the two DNA strands condense for base transfers c. old strands move to find new strands
DNA replication requires _______. a. DNA polymerase b. nucleotides c. primers d. all are required
The binding of _____ is required for transcription to start. a protein DNA polymerase RNA polymerase a transcription factor
Which of the following is part of the elongation step of DNA synthesis? pulling apart the two DNA strands attaching complementary nucleotides to the template strand untwisting the DNA helix none of the above
DNA replication requires ________ . a. DNA polymerase c. primers b. nucleotides d. all are required
Determine the complementary strand of DNA that forms on this template DNA fragment during replication: 5′GGTTTCTTCAAGAGA3′
The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat (newly synthesizing strand) slips out (loops out). Diagram what occurs in this and the next round of DNA replication. Describe the change in the DNA sequence that occurs due to this replication slippage. 5’TGCCAGTGTGT3’ACGGTCACACACACATGGAG5’
Complete the complementary strand: DNA replication ATTCGAGGCTAA
Arrange the following events of DNA replication in the proper order. A. DnaA binds DNA B. DNA polymerase binds to a free 3’ – OH C. Topoisomerases act D. Ori “melts/denatures”
Number the steps of DNA replication in the correct order (1, 2, 3) a) ______ Polymerase travels down the DNA parent strand b)______ DNA strands are unzipped c) ______ Ligase binds Okazaki fragments together