The structure below shows that of a polypeptide composed of multiple amino acid residues, some of which have undergone post-translational modifications intheir side chains.HN-NH2NHresidues.1) This polypeptide has2) Using one-letter abbreviations, the sequence of the polypeptide (before post-translational modification) is

Introduction The quaternary structure refers to the amount and arrangement of the protein subunits…

The structure below shows that of a polypeptide composed of multiple amino acid residues, some of which have undergone post-translational modifications in their side chains. NH2 residues. 1) This polypeptide has 2) Using one-letter abbreviations, the sequence of the polypeptide (before post-translational modification) is

The structure below shows that of a polypeptide composed of multiple amino acid residues, some of which have undergone post-translational modifications in their side chains. NH2 residues. 1) This polypeptide has 2) Using one-letter abbreviations, the sequence of the polypeptide (before post-translational modification) is

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 2CT

See similar textbooks

Similar questions

What polypeptides would be formed from the sequence UCAATGGGGUUUAUAGCG… (there are bases after the last G but we don’t know what they are so there may be some ambiguity for the last codon with regards to the amino acid possibilities) if the translation frame had UCA as the first codon: if the translation frame had CAA as the first codon: if the translation frame had AAT as the first codon:
a- Name the figure which shows the Co-translational translocation. A or B b -list the molecules which are required for Co-translational translocation. c- Suppose you want to impair the co-translational translocation of Star protein to ER. Which strategy you choose to prevent the translocation of the Star protein to ER and maintain it in the cytoplasm. Limit your answer to two sentences. asap please.
A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)
When glycoproteins are synthesized in the cell, at what stage of the polymerization of the protein are the sugar groups added: Prior to translation, cotranslationally, or posttranslationally?
Three E. coli tRNA molecules with the anticodon sequences CGG, OGG , and UGG are charged with the same amino acid. What is the amino acid ?
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What will be the overall anti-codon sequence in tRNA?
In prokaryotic protein synthesis, Nformylmethionine (fmet) is the first amino acid incorporated, whereas(normal) methionine is incorporated in eukaryotes. The same codon(AUG) serves both. What prevents methionine from being insertedinto the beginning and N-formylmethionine in the interior?
A segment in the middle of an mRNA has the sequence 5¿- AGAGAACCGCGA-3¿. Using the codon table, translate this sequence, assuming the first three nucleotides are a codon.
The following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…
What is the significance (or function) of tRNA in protein synthesis? In other words, explain why tRNA is so important. How many different tRNA’s are there?
Is this diagram of tRNA technically incorrect? Shouldn't it be 3' on the left and 5' on the right for the tRNA such that the 5' to 3' codon can match with the antiparallel 3' to 5' anticodon?
For the codon sequence : 5’ GGA – AUA – UGG – UUC – CUA – 3’ Write the Amino acid sequence produced in each of the following ways: Translation proceeds in a normal manner A mutation changes GGA to GGG A mutation changes GGA to CGA