The Structures of Genetic Material • DNA is made up of, called a DNA is made up of consisting of 3 parts: 1. 2. 3. Complementary base pairs There are pairs: 1. 2. 4. on one strand pairs with on the opposite strand on one strand pairs with on the opposite strand A DNA mutation, or genetic mutation, is a Making Exact Copies of DNA • DNA is replicated during interphase: • Double helix • Each strand of DNA serves as a Semi-conservative method of replication • Each of the new double-stranded DNA molecules contains: 3.

The Structures of Genetic Material • DNA is made up of, called a DNA is made up of consisting of 3 parts: 1. 2. 3. Complementary base pairs There are pairs: 1. 2. 4. on one strand pairs with on the opposite strand on one strand pairs with on the opposite strand A DNA mutation, or genetic mutation, is a Making Exact Copies of DNA • DNA is replicated during interphase: • Double helix • Each strand of DNA serves as a Semi-conservative method of replication • Each of the new double-stranded DNA molecules contains: 3.

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 4SA: One species DNA differs from others in its _______. a. nucleotides c. double helix b. DNA sequence...

See similar textbooks

Similar questions

This image shows DNA (gray) interacting with a computergenerated model of a TAL protein (multicolored), one of afamily of proteins found only in a species of the bacteriumXanthomonas. The bacterium uses proteins like this one to findspecific gene sequences in cells of the organisms it infects, suchas tomatoes, rice, and citrus fruits. Given what you know aboutDNA structure and considering the image above, discuss howthe TAL protein’s structure suggests that it functions
For entertainment on a Friday night, a genetics professor proposed that his children diagram a polynucleotide strand of DNA. Having learned about DNA in preschool, his 5-year-old daughter was able to draw a polynucleotide strand, but she made a few mistakes. The daughter’sdiagram (represented here) contained at least 10 mistakes. Q. Draw the correct structure for the polynucleotide strand.
Double-helical DNA has major and minor grooves becauseA. DNA-binding proteins twist the DNA into a specific shaveB. The A:T and G:C basepairs have different dimensionsC. Purines, being larger, form the major groove while pyrimidines, being smaller, form the minor grooveD. The phosphoribose backbones of the two strands are not diametrically oppositeE.
If I'm any organism a dna molecule is 24% cytosine, how much adenine will that dna molocule contian
For DNA ORF ATG.CTG.GTA.CTN.GTA.AAA, where N stand for any nucliotide (A, T, G, C) claculate the probablity of occurance of any nucliotide at position N.
Chromosomal ____________include those that removeor add base pairs (deletions and duplications), and thosethat relocate DNA regions (inversions and translocations).
The two strands for the helix-shaped DNA molecule are heldtogether by electrostatic forces as shown in class. Due to electron sharing, themagnitude of the net average charge on the H and N atoms, each, is 0.2e. Thenet average charge on the C and O atoms, each, is 0.4e. The distance betweenany two adjacent atoms on the same molecule is 0.1nm. Since electric fieldsdecrease as an inverse square law, they die off quickly with distance. So, theonly fields that really contribute to any given bond are due to the 3 atomsalong the red dotted line in the class diagram (two atoms on one'molecule andone atom on the other molecule).Calculate the electric fields and net force between a thymineand an adenine pair.=Calculate the electric fields and net force between a cytosineand a guanine pair.nConsider the OHN bond in the AT nucleotide. Can theelectric field be zero anywhere along the axis of this bond? If not,explain why not. If so, find where the electric field is zero.
Match the following terms with their descriptions:Heredity (a) Threadlike molecule of DNA,Chromosome typically circular in prokaryotesPhenotype (b) Permanent alteration in DNAGene (c) Involves the transmission ofAlleles information from an organismMutation to its progenyGenotype (d) Refers to the genetic informa- tion contained in the DNA of an organism (what it actually is) (e) The specific characteristics displayed by the organism (what it appears to be) (f) Linear sequence of DNA that carries coded instructions for…
For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strand
A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence onthe complementary DNA strand.
One stand of DNA reads: GACTTCAGATC Whay would the complementary strand be?
When a double-stranded DNA molecule is exposed tohigh temperature, the two strands separate, and themolecule loses its helical form. We say the DNA hasbeen denatured. (Denaturation also occurs whenDNA is exposed to acid or alkaline solutions.)a. Regions of the DNA that contain many A–T basepairs are the first to become denatured as the temperature of a DNA solution is raised. Thinkingabout the chemical structure of the DNA molecule, why do you think the A–T-rich regionsdenature first?b. If the temperature is lowered, the original DNAstrands can reanneal, or renature. In addition to thefull double-stranded molecules, some molecules ofthe type shown here are seen when the moleculesare examined under the electron microscope. Howcan you explain these structures?