The use of dideoxynucleotide triphosphates in the Sanger method facilitates sequencing of polynucleotides. Why? A. Fragments are generated with the terminal ends corresponding to the complement of the DNA being sequenced. B. Incorporation of the specific dideoxynucleotides terminates polymerization of the newly synthesized DNA. C. Dideoxynucleotides are randomly incorporated to the growing polypeptide chain D. Both A and B E. All of these

The use of dideoxynucleotide triphosphates in the Sanger method facilitates sequencing of polynucleotides. Why? A. Fragments are generated with the terminal ends corresponding to the complement of the DNA being sequenced. B. Incorporation of the specific dideoxynucleotides terminates polymerization of the newly synthesized DNA. C. Dideoxynucleotides are randomly incorporated to the growing polypeptide chain D. Both A and B E. All of these

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Similar questions

In experiments using polymerase chain reactions (PCR), it is often more difficult to amplifythrough regions of DNA that are high in GC content versus those regions that are either lower inGC content or are AT-rich. Based on your knowledge of DNA structure, explain why.
A. A plasmid is shown with the locations of various restriction enzyme sites labeled. If you cut the plasmid with Xhol and Xbal, which lane of the agarose gel represents the DNA fragments you would expect from the digestion? B. If you now decide to cut the plasmid with EcoRI, how many fragments will be produced and what will their sizes be? C. When running DNA samples on agarose gel, an electric field is applied. Towards which electrode will the DNA migrate and why?
Consider a partial restriction digestion, in which genomic DNA is exposed to a small, limiting amount ofa restriction enzyme for a very short period of time.a. Would the resultant fragments be longer or shorteror the same size as those produced by a completedigestion?b. If you prepared genomic DNA from a tissue sample containing millions of cells, would the fragments produced by partial digestion of DNA fromall of these cells be the same or different?
With regard to dideoxy sequencing, which of the following statementsis false?a. The dideoxy nucleotides are fluorescently labeled.b. The dideoxy nucleotides cannot be incorporated into a growingDNA strand.c. When incorporated into a DNA strand, the dideoxynucleotidesprevent further growth of the strand.d. The dideoxy sequencing method is used to determine the basesequence of DNA.e. The dideoxy sequencing method requires the use of primers.
Does the addition of a histidine tag affect DNA polymerase activity and or processivity? Give a detailed explanation.
With regard to Chargaff’s experiment described in Figure shown,answer the following:A. What is the purpose of paper chromatography?B. Explain why it is necessary to remove the bases in order todetermine the base composition of DNA.C. Would Chargaff’s experiments have been convincing if theyhad been done on DNA from only one species? Discuss.
Chargaff determined the base composition of DNA from a variety ofdifferent sources.What information do you know based onthe question and based on your understanding of thetopic?.
The goal of many computer programs is to identify sequence elementswithin a long segment of DNA. What is a sequence element? Givetwo examples. How is the specific sequence of a sequence elementdetermined? In other words, is it determined by the computer programor by genetic studies? Explain.
Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The highlighted sequences indicate the region bound by primers, either on this strand or on the other complementary strand. 5' ACGTGCGACACGTATATATGTCGCGTGAGTGTAGCGTATCGCTAGAGACGCATACCTATG 3' If the sequence of the forward primer is 5' GCGACACG 3', which of the following sequences would represent the reverse primer? a. 5’ – CAGAGATCGC – 3’ b. None of these sequences would represent the reverse primer c. 5’ – GTCTCTAGCG – 3’ d. 5’ – GCGATCTCTG – 3’ e. 5’ – CGCTAGAGAC – 3’
Base analogs are mutagenic because of which characteristic? a. They produce changes in DNA polymerase that cause it to malfunction. b. They distort the structure of DNA. c. They are similar in structure to the normal bases. d. They chemically modify the normal bases.
In the dideoxy-sequencing reaction, what terminates DNA synthesis at a particular base? a. The absence of a base on the ddNTP halts the DNA polymerase. b. The ddNTP causes a break in the sugar–phosphate backbone. c. DNA polymerase will not incorporate a ddNTP into the growing DNA strand. d. The absence of a 3′-OH group on the ddNTP prevents the addition of another nucleotide.
Consider the following segment of DNA, which is part ofa much longer molecule constituting a chromosome:5′.…ATTCGTACGATCGACTGACTGACAGTC….3′3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′If the DNA polymerase starts replicating this segmentfrom the right,a. which will be the template for the leading strand?b. Draw the molecule when the DNA polymerase ishalfway along this segment.c. Draw the two complete daughter molecules.d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual modeof replication?