a. Explain how the sea urchin and salmon data demonstrate both of Chargaff’s rules b. How significant is the Chargaff’s rule in the creation of the DNA model? c. You are a molecular biologist and you observed that the amount of the combined purine nitrogenous base in the DNA of an unknown species of freshwater fish in your vicinity is equivalent to 68%, and you determined that it possesses 16% Thymine in its RNA. How much Adenine, Guanine and Cytosine is present in the DNA of this freshwater fish? Explain how you arrived at your answer.

a. Explain how the sea urchin and salmon data demonstrate both of Chargaff’s rules b. How significant is the Chargaff’s rule in the creation of the DNA model? c. You are a molecular biologist and you observed that the amount of the combined purine nitrogenous base in the DNA of an unknown species of freshwater fish in your vicinity is equivalent to 68%, and you determined that it possesses 16% Thymine in its RNA. How much Adenine, Guanine and Cytosine is present in the DNA of this freshwater fish? Explain how you arrived at your answer.

Name: a. Explain how the sea urchin and salmon data demonstrate both of Char
Uploaded: 2022-11-30T17:34:22.000Z
Channel: Bartleby
Description: a. Explain how the sea urchin and salmon data demonstrate both of Chargaff’s rulesb. How significant is the Chargaff’s rule in the creation of the DNA model? c. You are a molecular biologist and you observed that the amount of the combined purinenitr

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 2DAA: HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952...

See similar textbooks

Similar questions

Results obtained from a Nano Spec. DNA samples collected: ng/uL A260/A80 A260/A230 E.coli genomic DNA 45.3 1.68 0.84 pEMBL1.9 26.0 1.80 1.09 pBluescript 82.1 1.90 1.89 What does this results tell us about the purity of the DNA samples? What are possible contaminations that may have occured?
How many nanograms of DNA should we expect to be contained within the slowest band from the HinDIII-digest of pGLO?
A bacterium has a genome size of 4.4 Mb. If a researchercarries out shotgun DNA sequencing and sequences a totalof 19 Mb, what is the probability that a base will be leftunsequenced? What percentage of the total genome will beleft unsequenced?
Why is the DNA polymerase used in PCR derived from an extreme thermophile bacteria species rather than a mesophile bacteria species? (be sure to describe the mesophile DNA polymerase as well as the extreme thermophile DNA polymerase.)
28.Bacteria X contains the double stranded DNA sequence below. Our task is to design a labelled primer (probe) to detect this sequence. Which sequence below can be used for this task? Identify the single most correct answer below. * indicates a label 5' ATGCTTTTTTTAAACCCCGGGGTTTT 3' 3'TACGAAAAAATTTGGGGCCCCAAAA 5' a) 3' AATTTGGGGC* ( b) 3' ATGCTTTTTT* ( ) c) 5' TTTAAAGGG* 19 ( ) d) 5' ATGCTTTTTT* ) e) a and b () f) a and d 23 g) b and d 29.Ames assay is patented, so 2nd yr microbiology students devised a new assay where wild type GFP (green florescence protein AKA light producing) is used as the target gene, for mutation rate analysis. When compound A is added, even in very low concentrations, all colonies formed end up producing light (produce fluoresce). Therefore, one can conclude that compound A is a strong mutagen. () True False 30.The consensus SD (Shine/Dalgarno sequence) is 5' AGGAGGU. Identify the single most correct answer below. a) The SD sequence 3' AGGAGGU is stronger than…
Explain the imporatnce of the Joshua Lederberg and Edward Tatum experiment (1946) as it relates to bacterial DNA.
A short micrococcal nuclease digestion yielded DNA fractions of 700, 1400, and 2100 bp. Predict what these fractions represent. What conclusions can be drawn?
give the significance/role/effect of the reagent/condition in the isolation or analysis of a biomolecule. using citrate buffer (ph 4.5) instead of Tris-HCl buffer (ph 7.5) during the DNA isolation
Alcohol is considered to be a significant reagent for the isolation of nucleicacids (RNA and DNA). Why is this so?
DNA isolated from the bacterial virus M13 con-tains 25% A, 33% T, 22% C, and 20% G. Do these resultsstrike you as peculiar? Why or why not? How might youexplain these values?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. How did the researchers know that the radioisotopes in the fluid came from outside of the bacterial cells and not from bacteria that had been broken apart by whirling in the blender?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. After 4 minutes in the blender, what percentage of each isotope was extracellular?