There are 2 parts to this question: The following DNA strand (below) is about to undergo DNA replication. a) Please replicate the parental strands into two exact copies TC GATATC G G AGCTATAGCC b) place a centromere between the two replicated copies (or tell me where the centromere would be located),

There are 2 parts to this question: The following DNA strand (below) is about to undergo DNA replication. a) Please replicate the parental strands into two exact copies TC GATATC G G AGCTATAGCC b) place a centromere between the two replicated copies (or tell me where the centromere would be located),

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter21: Dna, Genes, And Biotechnology

Section: Chapter Questions

Problem 1RQ: Why is DNA replication called semiconservative?

See similar textbooks

Similar questions

Considering prokaryotes, what term adds nucleotides in the 5' to 3' direction during DNA replication?
True or false: After chromosomal replication, Type I topoisomerase is used to coil up the double-stranded DNA?
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side
Which of the following is NOT correct concerning the initiation of replication in E. coli? Question 29 options: A) It involves a region of the DNA called oriC. B) DnaA proteins bind to the DNA to begin separation of the strands. C) The strands are initially separated at GC-rich regions of DNA. D) Following initial separation, enzymes continue to separate the parental DNA strands around the rest of the chromosome.
During high stress environments, it has been found that some bacteria activate a genetic mechanism that allows them to incorporate more mutations into the DNA during replication. Would the following two enzymes be impacted by such a mechanism? (i)DNA polymerase IIIii) Helicase
Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?
Eukaryotic chromosomes have multiple origins of replication. Why would this be the case?
If a eukaryotic chromosome has 25 origins of replication, how many replication forks does it have at the beginning of DNA replication?
A circular molecule of DNA contains 1 million base pairs. If the rate of DNA synthesis at a replication fork is 100,000 nucleotides per minute, how much time will theta replication require to completely replicate the molecule, assuming that theta replication is bidirectional? How long will replication of this circular chromosome by rolling-circle replication take? Ignore replication of the displaced strand in rolling-circle replication.
The following DNA sequence is at the start of a DNA strand: 3'—AATTCGAGATTCA—5'. Which of the primer sequences below would be synthesized from this strand by DNA primase to initiate DNA replication? Group of answer choices a 3'—TTAACGTCTAAGT—5' b 3'—UUAAGCUCUAAGU—5' c 5'—TTAACGTCTAAGT—3' d 5'—UUAAGCUCUAAGU—3'
Does E. coli chromosomal replication always start at one particular site? What is called? If you were given the DNA sequence of E. coli chromosome, would you be able to identify where E. coli chromosomal replication starts? What is the end of E. coli chromosome replication?
Assume that a certain bacterial chromosome has one origin of replication. Under some conditions of rapid cell division, replication could start from the origin before the preceding replication cycle is complete. How many replication forks would be present under these conditions?