Below is a depiction of a replication bubble.5' AGCTCCGATCGCGTAACTTT3'TCGAGGCTAGCGCATTGAAACTAAAGCTTCGGGCATTATCG 3'GATTTCGAAGCCCGTAATAGCTATCGACSConsider the following primer which binds to the DNA replication bubble on the diagram above:5'-GCUAUCG-3'Identify the DNA sequence to which this primer would bind and the orientation.If the replication fork moves to the right, will the primer be used to create the leading strand of replicationor the lagging strand? Explain your answerb. If the replication fork moves to the left, will the primer be used to create the leading strand of replication ora.the lagging strand? Explain your answer.What would the next five nucleotides added to the primer by DNA polymerase?С.

Without the enzymes, DNA replication is incomplete. The initiation, elongation, termination, and…

elow is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA CTAAAGCTTCGGGCATTATCG 3' GATTTCGAAGCCCGTAATAGC CTATCGAGO Consider the following primer which binds to the DNA replication bubble on the diagram above: 5'-GCUAUCG-3'

elow is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA CTAAAGCTTCGGGCATTATCG 3' GATTTCGAAGCCCGTAATAGC CTATCGAGO Consider the following primer which binds to the DNA replication bubble on the diagram above: 5'-GCUAUCG-3'

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 18QP: Replication involves a period of time during which DNA is particularly susceptible to the...

See similar textbooks

Related questions

Q: A circular molecule of DNA contains 1 million base pairs. If the rate of DNA synthesis at a…

A: in prokaryotes, the genomic DNA is in a circular format and adopt the theta replication model,…

Q: This is the original strand of DNA: ATG AAG TTT GGC TAA - what would represent a frameshift mutation…

A: A mutation refers to any alteration in the sequence of DNA (deoxyribonucleic acid) due to some…

Q: At a specific area of this chromosome, the sequence of nucleotides below is present where the chain…

A: The region of DNA known as the replication fork is where the replication process itself is now…

Q: Which 2 primers will copy the entire sequence of DNA: 5'…

A: Primer is a short nucleotide sequence which is required to initiate DNA replication . To the primers…

Q: ЗА. This DNA after Bsal digestion, produces a DNA fragment with sticky ends as shown in the figure…

A: Introduction :- DNA strands are digested with the help of various restriction enzymes .Bsal is an…

Q: Complementary DNA strand of 5'-ATTCGTATTCCCGCGGTGCAAC-3' OA.) 5-TAAGCATAAGGGCGCCACGTTG-3' OB.) 3-…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: Explain in not more than 5 sentences. If deoxyribonucleotides that lack the 3’-OH groups are added…

A: Deoxyribonucleotides are the nucleotides which lacks a hydroxyl group at 2' OH of ribose sugar.…

Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…

A: Primer is short sequence which is complementary to the base sequence of DNA and is considered to be…

Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…

A: According to the question, we have to answer the question that which is for the chromatograph below,…

Q: In bacterial cells, nucleotide excision repair involves which of the following proteins? DNA…

A: The principal method utilised by mammals to remove bulky DNA lesions such as those caused by UV…

Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…

A: The ds DNA strand between position 20-30 3'- GATACGCGATG- 5' The sequence of primer that will be…

Q: Which protein directs the recombination exchange with a DNA that has failed a complete DNA…

A: DNA unwinds and the two strands detach at the "replication origins" a little at a time, like a…

Q: The spontaneous loss of amino groups from adenine inDNA results in hypoxanthine, an uncommon base,…

A: The mutation is the DNA damage and can be due to radiation, chemicals, methylated bases, and due to…

Q: What are the components that an origin of replication can contain? a. An origin recognition…

A: Cell division in organisms is often accompanied by the replication of genetic material. In bacteria…

Q: 4.8. The figure below shows a snippet of DNA in the process of being replicated. The RNA primer is…

A: DNA replication is the process by which DNA makes a copy of itself during cell division. In order to…

Q: 1 Annotate Figure 16.5, which is a schematic of the replication fork. a. In each box, write the name…

A: DNA replication The process by which DNA duplicate itself.

Q: 12. A sequence of nucleotides is shown below, along with an indication of an origin of replication:…

A: Replication is the process of synthesizing new DNA from the parental DNA.

Q: I need question 43

A: The double-stranded DNA break can be a cause of oxidizing agents, replication errors, and ionizing…

Q: In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Solid…

A: Okazaki fragments are short stretches of DNA on the lagging strand, which are synthesized in the…

Q: How would nucleotide excision repair be affected if one of the followingproteins was missing?…

A: The process of identification and correction of damaged DNA molecule by a cell which encodes its…

Q: Indicate the proteins involved in the following steps of DNA replication in E. coli a. ___________…

A: DNA replication is the process in which the DNA copies itself to form another DNA. This is the first…

Q: (i) Indicate by drawing where the RNA of Telomerase binds to the telomeric region. W, X, Y, and Z…

Q: Replication is occurring normally in these cells; would you expect to find a primer in both…

A: DNA replication is a semiconservative, semicontinuous, and bidirectional process. It occurs in the S…

Q: Consider the following segment of DNA, which is part ofa much longer molecule constituting a…

A: Deoxyribonucleic acid, or DNA, could be a molecule that contains the directions AN organism must…

Q: Why are Okazaki fragments formed? A. Okazaki fragments are the result of discontinuous replication…

A: Answer : Option "E" is correct - Okazaki fragments are formed when the 5'-3' complementary strand…

Q: . Draw a replication bubble with both replication forksand label the origin of replication, the…

A: The area where the replication of DNA occurs called replication fork. When double helix is opened…

Q: Given the structures of ddATP and DATP: NH2 NH2 N. HO-P- OH OH OH OH OH OH ddATP DATP A) What would…

A: Chain termination method relies on the use of dideoxyribonucleoside triphosphates, derivatives of…

Q: What is true of this figure? (can be multiple answers) a. the replication fork is asymmetrical b.…

A: DNA is the genetic material of an organism. DNA replication is a process in which two DNA molecules…

Q: Considering that DNA is synthesized in the 5' to 3' direction, which direction must DNA polymerase…

A: Introduction: Biological information is transferred from DNA to RNA and then to proteins. This is…

Q: Draw a molecule of DNA undergoing eukaryotic linear replication. On your drawing, identify (a)…

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…

Q: DNA that has been labeled with 15N is used as the template for replication. Replication is carried…

A: Watson and Crick proposed that the double-strand DNA (dsDNA) replication is a semiconservative…

Q: An investigator obtalns a bacterial temperature-sensitive mutation that affects a step in the…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: 3r 5' C ACAA AGGAAT Primer 5'-CUU-3' is being used to replicate this piece of DNA. What strand this…

A: DNA is a nucleic acid with deoxyribose sugar that is responsible for the inheritance of traits. The…

Q: In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Solid…

A: During replication forks, Okazaki fragments are transient components of lagging strand DNA…

Q: On paper, replicate the following segment of DNA: 5’ A T C G G C T A C G T T C A C 3’…

A: DNA replication is a complex process of producing copies of the entire chromosome using the…

Q: DNA Replication For the following piece of DNA, draw the replicated piece of DNA the original and…

A: DNA replication is a process by which one molecule of DNA replicates and results in two daughter DNA…

Q: 5'-TTAGGGAACCCTCACTGAATGAATGAATG AATGAATGAATGAATGAATGAATGAATGAATGTTTGGGCAAATAAACGCTG-3' Re-type (or…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: Taq polymerase is a bacterial thermostable DNA polymerase that has a relatively low replication…

A: Taq polymerase is an enzyme used to amplify DNA in Polymerase chain reactions. Taq polymerase is a…

Q: In bacterial cells, nucleotide excision repair involves which of the following proteins? A. DNA…

A: DNA A deoxyribonucleic acid polymer that present in the nucleus and carry genetic information.

Q: Explain the replication process shown in the diagrams below: For image A) describe what process is…

A: DNA, or deoxyribonucleic acid, is the genetic material in almost all organisms. Genetic information…

Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAA…

A: DNA is formed of four types of nitrogenous bases, which are adenine, thymine, guanine, and cytocine.…

Q: In the following diagram of DNA replication fork, A is a subunit of DNA polymerase Ill. O b. y…

A: DNA polymerase III is used in the synthesis of Chromosomal DNA. DNA pol III participates in the DNA…

Q: Which of the following is NOT TRUE about replication? A. Polynucleotides are made up of…

A: DNA replication in eukaryotes is semiconservative, semicontinuous, and bidirectional. It occurs in…

Q: Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in…

A: Inversions are half-circle rotations of a region of a single chromosome. It is important to remember…

Q: Using the correct base pairing rules for DNA replication, what would be the complementary strand for…

A: Rules of base pairing A with T: The purine adenine(A) always pairs with the pyrimidine Thymine…

Q: Arrange the steps in the base excision repair process. Write the capital letter corresponding each…

A: Base excision repair Base excision repair is a DNA repairment mechanism in which the incorrect…

Q: Question 44 please

A: NHEJ or non-homologous end joining is a type of repair mechanism present in almost all organisms.…

Q: Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT…

A: DNA has a double helix structure composed of sugar, phosphate group, and four nitrogen bases.…

Q: 1. (a) An E. cofi DNA plasmid has 5.64 x 10 base pairs. The plasmid contains a single origin and a…

A: DNA replication is the process of producing two identical copies of DNA from one double stranded DNA…

Question

Below is a depiction of a replication bubble.
5' AGCTCCGATCGCGTAACTTT
3'
TCGAGGCTAGCGCATTGAAA
CTAAAGCTTCGGGCATTATCG 3'
GATTTCGAAGCCCGTAATAGC
TATCGACS
Consider the following primer which binds to the DNA replication bubble on the diagram above:
5'-GCUAUCG-3'
Identify the DNA sequence to which this primer would bind and the orientation.
If the replication fork moves to the right, will the primer be used to create the leading strand of replication
or the lagging strand? Explain your answer
b. If the replication fork moves to the left, will the primer be used to create the leading strand of replication or
a.
the lagging strand? Explain your answer.
What would the next five nucleotides added to the primer by DNA polymerase?
С.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Figure 14.14 You isolate a cell strain in which the joining of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?
Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
How does DNA replication occur in a precise manner to ensure that identical genetic information is put into the new chromatid? See Figures 8.12 and 8.13. FIGURE 8.12 In DNA replication, the two polynucleotide strands uncoil, and each is a template for synthesizing a new strand. A replicated DNA molecule contains one new strand and one old strand. This mechanism is called semiconservative replication. FIGURE 8.13 A close-up look at the process of DNA replication. (a) As the strands uncoil, bases are added to the newly synthesized strand by complementary base pairing with bases in the template strand. The new bases are linked together by DNA polymerase. (b) DNA synthesis can proceed only in the 5 3 direction; newly synthesized DNA on one template strand is made in short segments and linked together by the enzyme DNA ligase.
Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand is from 39 to 59. b. Synthesis of the new DNA strand is from 59 to 39. c. DNA unwinds, primase adds RNA primer, and DNApolymerases synthesize the new strand and remove the RNAprimer. d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite directionfrom the direction in which the replication fork moves.
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…
The following DNA sequence is at the start of a DNA strand: 3'—AATTCGAGATTCA—5'. Which of the primer sequences below would be synthesized from this strand by DNA primase to initiate DNA replication? Group of answer choices a 3'—TTAACGTCTAAGT—5' b 3'—UUAAGCUCUAAGU—5' c 5'—TTAACGTCTAAGT—3' d 5'—UUAAGCUCUAAGU—3'
Draw a replication origin in E. coli. Place the first 4 primers in the figure. Show how the replication would proceed. Label polarity of ALL template and growing (newly synthesized) strands. Show direction of synthesis on all growing strands and identify all leading and lagging strands (I do not want you to mention or describe the enzymes involved). please give answer asap
During DNA replication, the function of RNA primers is to Group of answer choices serve as a binding site for DNA ligase separate the two strands of the double helix to open replication "bubbles" serve as starting points for DNA strand elongation by DNA polymerase in the 3' - 5' direction prevent new-separated strands of DNA from rejoining serve as starting points for DNA strand elongation in the 5' - 3' direction by DNA polymerase
Examine the following DNA sequence (only one strand is shown). The shown strand will be referred to as Strand 1. The complementary strand will be referred to as Strand 2: 5’ TTTAAGCCGTACCGATATAATGTAAGGCGAGCTTGACCGTCTTGGGCATCATA 3’ There is an eleven (11) base pair sequence that serves as a replication origin. Write below the most likely 11 nucleotides on this strand that serve as the replication origin. Think carefully about base pairing.
Sketch a LARGE labeled figure showing one replication fork and the synthesis of one leading strand and two lagging strands of DNA in the replication bubble. Label the 5’ and 3’ ends of all DNA strands shown in your figure. Also label any DNA polymerases, DNA helicases, primases and primers. (For this question you may assume that lagging strands have not been joined.)