There are three different chitin synthase genes that control the chitin synthesis in Saccharomyces cerevisiae, namely CHS I, CHSII, and CHSIII. If a mutation occurs in each of
Q: Antibiotics such as chloramphenicol, tetracycline, and erythromycin inhibit protein synthesis in…
A: The mode action is different in different antibodies. Erythromycin mechanism of action includes the…
Q: Is there any possible treatments for Homo sapiens phenylalanine hydroxylase (PAH) gene?
A: Phenylalanine hydroxylase deficiency is an autosomal recessive condition in which the essential…
Q: If you could microinject cytochrome c into the cytosol of wild-type mammalian cell and another set…
A: Cytochrome c was microinjected into the cytosol of wild-type mammalian cell .Another type of cells…
Q: Bacillus subtilis is known to harbour proA gene which is expressed as protease. Protease is an…
A: Genetic engineering and bioprocess are very good tools in the pharmaceutical, therapeutics, enzyme…
Q: Why the process of DNA is transcribed into mRNA and then translated into protein is referred to as…
A: Note - we are supposed to answer 1 question according to the guidelines. Please repost the other…
Q: Tay–Sachs disease is a severe autosomal recessive genetic disease that produces deafness, blindness,…
A: Tay-Sachs disease is a neurodegenerative disease that is caused by the mutation of the gene HEXA…
Q: What is mutation in yeast?
A: Yeast is a eukaryotic unicellular organism that belongs to the kingdom Fungi. These organisms are…
Q: How would a dominant-negative Arf1 protein affect (or not) the following processes.…
A: Arf1 is a small GTPase that is involved in vesicular transport. It has been shown to play a role in…
Q: What are the components needed for the processes of transformation, conjugation, and transduction?…
A: 1.The genetic transfer in bacteria happens through three major processes.They are:…
Q: Describe the function of CYP3A4?
A: Answer- CYP3A4 or cytochrome P450 3A4 is a human enzyme that is present and synthesized in the…
Q: How is the Mc1R gene synthesized from chromosomes and how does it produce itself into a melanocortin…
A: A DNA molecule comprises functional units called genes. Each gene provides instructions for a…
Q: What are degenerativediseases?
A: Degenerative disease is caused by a continuous process based on degenerative(negative) cell changes,…
Q: How does the HAEIII enzyme discriminate between the C-G polymorphism in the TAS2R38 gene?
A: HaeIII catalyst cuts at the A GG:CC which is found at nucleotides 143-146 of the TAS2R38 gene. The…
Q: What are master genes? Explain why they are not present in prokaryotes.
A: Genes are a set of instructions that define how an organism looks, how it lives, and how it…
Q: The Perrier1 mutation of Chlamydomonas results in cells unable to generate ATP by oxidative…
A: Oxidative phosphorylation is the process in which ATP is formed as a result of transfer of electrons…
Q: After donating its phosphate molecule to adenosine diphosphate (ADP), which compound helps restore…
A: A great extent of ATP is required for the movement of muscles. So once muscle contraction starts and…
Q: What is the effect of pertussis toxin on G proteins? Inhibits activation of Gαi leading to…
A: The GPCR (G-protein coupled receptor) is one of the very important cell signalling molecule. It is a…
Q: The DNA located inside of mitochondria exhibits approximately ten times the mutation rate seen in…
A: Mitochondria is a double membrane-bound cell organelle that is used to generate ATP molecules…
Q: Which form of Retinoblastoma typically results in unilateral disease and exhibits 2-hit mutational…
A: Retinoblastoma is a cancer that affects the eyes. It is specifically a cancer of retinal layer of…
Q: How many functional copies of ɑAA reductase does a yeast cell need in order to perform lysine…
A: Haploid cell contains one set of all the chromosomes. Diploid cell contains two sets of all the…
Q: why is the HbS mutation so prevalent in Africa and in some other regions?
A: A severe hereditary form of anemia is named Sickle cell anemia. It is generated by the mutation,…
Q: What is unusual about the genes that encode mitochondrialproteins?
A: Mitochondria Mitochondria are the powerhouse of the cell. It is a double membrane-bound organelle…
Q: What is the definition of BMR and what does BMR stand for
A: Metabolism involved anabolism (synthesis of molecules with consumption of energy, few number of…
Q: In humans, the disease cystic fibrosis is caused by a recessive allele for a gene that encodes a…
A: Given that, in human, cystic fibrosis occurs when recessive allele for a gene (encodes specific type…
Q: What are the molecular mechanisms leading the oncogenic transformation of proto- oncogenes?
A: Proto-oncogene It is a normal gene, which when altered by mutation changes into an oncogene, which…
Q: What will be the intervening variables for the anticancer activity of the leaves and fruits of…
A: Moringa Oleifera is a native Indian plant, used as a source of various vitamins and minerals. Its…
Q: Which of the following plays a role in repairing thymine dimers by reversing the damage caused by UV…
A: A permanent change in the DNA’s base sequence is termed as mutation. The agents that cause mutation…
Q: Which Class I element has likely experienced the greatest accumulation of mutations compared to its…
A: Transposable elements are the Jumping genes which are the mobile genetic material within the genome.…
Q: The GAL gene system in yeast is used to metabolize galactose. In the prese galactose, the GAL genes…
A: In order to study the gene regulation in eukaryotic cells, normally yeast cells are used in the lab.…
Q: How many different types of mutations can result in lactase persistence and what are their names?
A: The functional activity of the Lactase enzyme even in adulthood is termed as Lacatse persistence,…
Q: The Saccharomyces cerevisiae nuclear gene ARG8encodes an enzyme that catalyzes a key step in…
A: Gene refers to the specific segment of DNA in a discrete region of the chromosome. It encodes a…
Q: What does colchicine do to the cell's size and how does it cause mutation to cells?
A: Colchicine are generally called as anti-gout agents, which works by arresting the natural processes…
Q: What are the amino acids encoded by gene Z?
A: Given information The promoter is from the 20-55th position in the sequence. The ribosome binding…
Q: Under which conditions would expression of glutamate decarboxylase increase the relative fitness of…
A: The relative fitness of bacteria is defined as the susceptibility of bacteria to adjust, grow and…
Q: What is the role of the lacZ gene product, the enzyme B-galactosidase?
A: An operon is a functional unit of DNA (Deoxyribonucleic acid) containing a cluster of genes under…
Q: You have identified five genes in S. cerevisiae that are induced when the yeast are grown in a…
A: In order to replace the gene with a positive selectable marker, each gene will use homologous…
Q: Why are mutations in the INK4 locus so dangerous?
A: INK4 is a cyclin-dependent kinase inhibitor family (CKIs). Inhibitors of CDK4 and CDK6 are…
Q: In our feeding experiment with vermilion/brown and cinnabar/brown mutant flies, we were supposed to…
A: kynurenine or hydroxykynurenine is a chemical compound that is produced when an amino acid called…
Q: What is the radioactive decay process of Isotype IgA?
A: Immunoglobulins are glycoprotein molecules, which are produced by the plasma cells. They act as a…
Q: What is the role of folate in pyrimidine synthesis and what is the consequence of a folate…
A: Folate is a kind of vitamin B. It is also known as vitamin B9. It is usually taken in the form of…
Q: Which of the following sets of genes are most likely to have pleiotropic effects?…
A: Pleiotropy is defined as a process in which one gene influences two or more two phenotypic traits.…
Q: For each of the following genotypes, explain how mutation (identified by a (-) will affect the…
A: The operon is the prokaryotic gene regulatory system that regulates the expression of polycistronic…
Q: What is the nature of the prion mutation that leads to extreme sensitivity to prion disease?
A: A misfolded protein can be defined as a protein that cannot get back to its normal native state due…
There are three different chitin synthase genes that control the chitin synthesis in Saccharomyces cerevisiae, namely CHS I, CHSII, and CHSIII. If a mutation occurs in each of these genes, what will happen to the S. cerevisiae?
Step by step
Solved in 3 steps
- What are the effects of Sxl mutations?A region on chromosome 6 has been linked to schizophrenia, but researchers have not found a specific gene associated with this disease. What steps would be necessary to locate the gene?The DNA located inside of mitochondria exhibits approximately ten times the mutation rate seen in nuclear DNA. Provide an explanation as to why this is the case and what are the effects of this higher mutation rate of mitochondrial DNA on disease processes?
- What are the treatments that help the ribosome do it’s job in the treacher collins syndrome? And how?Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A. mucopolysaccharidosis type II B. Turcot syndrome C. Haemophilia A D. Xeroderma pigmentosum E. Haemophilia B F. Ataxia Telangiectasia G. Noonan syndrome H. Li-fraumeni syndrome I. Hunter syndrome J. Ocular motor apraxiaYou have identified five genes in S. cerevisiae that are induced when the yeast are grown in a high-salt (NaCl) medium. To study the potential roles of these genes in acclimation to the growth in high-salt conditions, you wish to examine the phenotypes of loss- and gain-of-function alleles of each. How will you do this?
- I read that vinyl chloride exposure is associated with an increased risk of a rare form of liver cancer (hepatic angiosarcoma), as well as brain and lung cancers, lymphoma, and leukemia. But my question is what gene(s) are being mutated by this type of taxic gas?Identify the following by describing their functions: EF-G, EF-Tu, EF-Ts, EF-P, and peptidyl transferaseThe genetic alteration responsible for sickle-cell anemia in humans involves: a transition mutation from A to G, substituting glutamic acid for valine in a-globin a transversion mutation from T to A, substituting valine for glutamic acid in b-globin a transition mutation from T to C, substituting valine for glutamic acid in b-globin a transversion mutation from G to C, substituting glutamic acid for valine in a-globin a frameshift mutation of one ATC codon, removing glutamic acid from b-globin
- What is the role of folate in pyrimidine synthesis and what is the consequence of a folate deficiency during development?What property of RNA makes it capable of carrying out the functions of a ribozyme? What may be causing there to be such a scarcity of naturally occurring DNA enzymes?Three different chitin synthase genes control chitin synthesis in S. cerevisiae. Discuss what will happen to the budding yeast if a mutation occurs in each of the genes below: CHSI CHSII CHSIII