Answered: This molecule is most likely implicated…

Name: This molecule is most likely implicated in the renaturation of protein
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: This molecule is most likely implicated in the renaturation of proteins.Select one:a.chaperone (HSP)b.kinasec.RISCd.proteasomee.transcriptional factor

Science

Biology

This molecule is most likely implicated in the renaturation of proteins. Select one: a. chaperone (HSP) b. kinase c. RISC d. proteasome e. transcriptional factor

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 11RQ: Post-translational control refers to: a. regulation of gene expression after transcription b....

See similar textbooks

Similar questions

All genes regulated by PKA contain a cis-acting DNA sequence that binds to the phosphorylated form of a transcription factor called (choose one answer) a. CREB. b. C-Jun. c. beta-catenin. d. TCF.
A release factor is referred to as a “molecular mimic” because its structure is similar to a. a ribosome. b. an mRNA. c. a tRNA. d. an elongation factor.
After tmRNA releases an mRNA and aberrant polypeptide from a stuck ribosome, the resulting polypeptide will A) be translated B) be destroyed by a protease C) be inserted into the cell membrane D) be used to regulate gene expression
Write a short essay describing which types of trans-acting proteins bindto which type of cis-regulatory element ?
What is meant by the term attenuation? Is it an example of gene regulation at the level of transcription or translation? Explain your answer
The “A” site in the ribosome refers to the: A. binding site for charged t-RNA molecules during protein synthesis B. Site that allows for tRNAs to exit C. a site that holds the tRNA which is linked to the growing polypeptide chain D. none of these answeres
Number the following steps of protein synthesis in order in which they occur, starting with 1 and ending with 9. a. ____ the stop codon is reached, and the polypeptide is released b.____ the small ribosomal subunit finds the start codon, and the large ribosomal subunit joins. c.____ the end of the gene is reached, and the pre-mRNA is released and then edited. d. ____ The transcription factor bonds the promoter. e. ____ the protein is folded and modified to become functional. f. ____ RNA polymerase builds the mRNA transcript. g. ____ mRNA and initiator tRNA bind the small ribosomal subunit. h. ____ new tRNAs are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site. i. ____ mRNA exits the nucleus via a nuclear pore.
Number the following steps of protein synthesis in the order in which they occur, starting with 1 and ending with 9.a. _____ The stop codon is reached, and the polypeptide is released.b. _____ The small ribosomal subunit finds the start codon, and the large ribosomal subunit joins.c. _____ The end of the gene is reached, and the pre-mRNA is released and then edited.d. _____ The transcription factor binds the promoter.e. _____ The protein is folded and modified to become functional.f. _____ RNA polymerase builds the mRNA transcript.g. _____ mRNA and initiator tRNA bind the small ribosomal subunit.h. _____ New tRNA molecules are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site.i. _____ mRNA exits the nucleus via a nuclear pore.
Which of the following does not describe protein modifications? please explain the answer a.They can promote multiprotein complex formation b.They can target a protein for proper localization c.They can regulate protein stability d.They are always permanent changes
Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair
What is the fate of a protein that has a signal sequence?
Describe the relationship between protein expression level and protein activity level. How could a mutation alter the activity level and not the expression level.